Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TGAAAGTGACTACATCGGGGT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	1	w	17,825,731	Phasing window	AT1G48267	w	17,825,730	17,825,819	MIR161; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	1	w	17,825,731	Phasing window	ath-MIR161	w	17,825,685	17,825,857	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	658	4,877,516	135	270	675	1,349
C0F2	7	2,789,465	3	5	13	25
d1F1	444	3,574,742	124	248	621	1,242
d1F2	109	3,705,660	29	59	147	294
d234F1	671	1,417,116	473	947	2,367	4,735
d234F2	542	3,822,319	142	284	709	1,418
r2F1	2,100	2,195,923	956	1,913	4,782	9,563
r2F2	195	2,233,522	87	175	437	873
r2FSb	6,081	5,728,276	1,062	2,123	5,308	10,616
r2FNaSb	6,062	5,311,047	1,141	2,283	5,707	11,414
r2FNa1	1,819	1,834,656	991	1,983	4,957	9,915
r2FNa2	4,872	6,081,068	801	1,602	4,006	8,012
r2FL	670	1,145,942	585	1,169	2,923	5,847
r2FD	5,163	4,928,142	1,048	2,095	5,238	10,477
C0FCSb	145	9,399,678	15	31	77	154
C0FSb	496	9,361,008	53	106	265	530
r2SC1	805	3,743,342	215	430	1,075	2,150
r2SH	1,270	2,165,395	586	1,173	2,932	5,865
r2SNa1	75	2,082,930	36	72	180	360
r2SC3	2,453	3,997,922	614	1,227	3,068	6,136
r2SNa2	3,805	4,617,795	824	1,648	4,120	8,240
r2SSb	5,814	3,278,680	1,773	3,547	8,866	17,733
r2SNaSb	1,576	3,087,212	510	1,021	2,552	5,105
r2SC2	727	476,105	1,527	3,054	7,635	15,270
r2SP	541	976,646	554	1,108	2,770	5,539
C0RC1	2,490	1,249,181	1,993	3,987	9,967	19,933
C0RNi	5,213	1,211,490	4,303	8,606	21,515	43,030
AtCM	153	14,488,208	11	21	53	106
AT_Leaf	12,770	8,047,907	1,587	3,173	7,934	15,867
At_miR1507OX_1	1,207	1,478,373	816	1,633	4,082	8,164
At_miR1507OX_2	2,093	1,638,916	1,277	2,554	6,385	12,771
At_miR2109OX_1	1,154	1,760,055	656	1,311	3,278	6,557
At_miR2109OX_2	2,373	2,446,954	970	1,940	4,849	9,698
At_miR2118aOX_1	875	1,212,493	722	1,443	3,608	7,217
At_miR2118aOX_2	1,446	1,258,140	1,149	2,299	5,747	11,493
At_miR2118bOX_1	2,148	2,023,619	1,061	2,123	5,307	10,615
At_miR2118bOX_2	1,159	1,733,586	669	1,337	3,343	6,686
At_miR2118cOX_1	1,839	1,995,522	922	1,843	4,608	9,216
At_miR2118cOX_2	1,949	2,496,180	781	1,562	3,904	7,808
At_miROX_control	2,367	1,838,508	1,287	2,575	6,437	12,875
At_miROX_ck_2	1,932	1,804,409	1,071	2,141	5,354	10,707
hen1-8	271	5,456,831	50	99	248	497
hen1-8 ntp2-1	360	6,244,400	58	115	288	577
hen1-8 urt1-1	263	6,081,292	43	86	216	432
hen1-8 ntp4-1	386	4,626,878	83	167	417	834
hen1-8 ntp5-1	527	5,676,073	93	186	464	928
hen1-8 ntp6-1	2,733	4,328,718	631	1,263	3,157	6,314
hen1-8 ntp7-1	254	4,409,080	58	115	288	576
hen1-8 ntp8-1	485	8,736,008	56	111	278	555
hen1-8 ntp10-1	269	6,387,459	42	84	211	421
hen1-8 r2	70	2,874,203	24	49	122	244
hen1-8 heso1-1	1,678	6,015,054	279	558	1,395	2,790
hen1-8 mee44	189	3,435,030	55	110	275	550
Wt_d	1,706	7,517,450	227	454	1,135	2,269
Col_d	6,461	11,692,099	553	1,105	2,763	5,526

Link to FindMiRNA for this sequence