Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TGACAGAAGAAAGAGAGCAC
Length: 20 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	5	c	22,597,106	Phasing window	AT5G55835	c	22,597,012	22,597,117	MIR156H; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	5	c	22,597,106	Phasing window	ath-MIR156h	c	22,597,012	22,597,117	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	5,256	4,877,516	1,078	2,155	5,388	10,776
C0F2	2,982	2,789,465	1,069	2,138	5,345	10,690
d1F1	732	3,574,742	205	410	1,024	2,048
d1F2	1,413	3,705,660	381	763	1,907	3,813
d234F1	2,403	1,417,116	1,696	3,391	8,478	16,957
d234F2	12,094	3,822,319	3,164	6,328	15,820	31,640
r2F1	8,400	2,195,923	3,825	7,651	19,126	38,253
r2F2	4,325	2,233,522	1,936	3,873	9,682	19,364
r2FSb	32,747	5,728,276	5,717	11,433	28,584	57,167
r2FNaSb	51,162	5,311,047	9,633	19,266	48,166	96,331
r2FNa1	4,524	1,834,656	2,466	4,932	12,329	24,659
r2FNa2	79,733	6,081,068	13,112	26,223	65,558	131,117
r2FL	2,337	1,145,942	2,039	4,079	10,197	20,394
r2FD	29,661	4,928,142	6,019	12,037	30,093	60,187
C0FCSb	202	9,399,678	21	43	107	215
C0FSb	7,500	9,361,008	801	1,602	4,006	8,012
r2SC1	54	3,743,342	14	29	72	144
r2SH	788	2,165,395	364	728	1,820	3,639
r2SNa1	29	2,082,930	14	28	70	139
r2SC3	74	3,997,922	19	37	93	185
r2SNa2	144	4,617,795	31	62	156	312
r2SSb	25	3,278,680	8	15	38	76
r2SNaSb	39	3,087,212	13	25	63	126
r2SC2	0	476,105	0	0	0	0
r2SP	65	976,646	67	133	333	666
C0RC1	0	1,249,181	0	0	0	0
C0RNi	0	1,211,490	0	0	0	0
AtCM	3,249	14,488,208	224	449	1,121	2,243
AT_Leaf	36	8,047,907	4	9	22	45
At_miR1507OX_1	0	1,478,373	0	0	0	0
At_miR1507OX_2	1	1,638,916	1	1	3	6
At_miR2109OX_1	0	1,760,055	0	0	0	0
At_miR2109OX_2	1	2,446,954	1	1	2	4
At_miR2118aOX_1	0	1,212,493	0	0	0	0
At_miR2118aOX_2	1	1,258,140	1	2	4	8
At_miR2118bOX_1	0	2,023,619	0	0	0	0
At_miR2118bOX_2	0	1,733,586	0	0	0	0
At_miR2118cOX_1	0	1,995,522	0	0	0	0
At_miR2118cOX_2	0	2,496,180	0	0	0	0
At_miROX_control	0	1,838,508	0	0	0	0
At_miROX_ck_2	0	1,804,409	0	0	0	0
hen1-8	52	5,456,831	10	19	48	95
hen1-8 ntp2-1	42	6,244,400	7	13	34	67
hen1-8 urt1-1	70	6,081,292	12	23	58	115
hen1-8 ntp4-1	55	4,626,878	12	24	59	119
hen1-8 ntp5-1	76	5,676,073	13	27	67	134
hen1-8 ntp6-1	590	4,328,718	136	273	681	1,363
hen1-8 ntp7-1	59	4,409,080	13	27	67	134
hen1-8 ntp8-1	88	8,736,008	10	20	50	101
hen1-8 ntp10-1	68	6,387,459	11	21	53	106
hen1-8 r2	27	2,874,203	9	19	47	94
hen1-8 heso1-1	60	6,015,054	10	20	50	100
hen1-8 mee44	45	3,435,030	13	26	66	131
Wt_d	627	7,517,450	83	167	417	834
Col_d	200	11,692,099	17	34	86	171

Link to FindMiRNA for this sequence