Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGACATGGGACTGCCTAAGCTA
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15c4,479,469Phasing windowAT5G13887c4,479,3974,479,591MIR848a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25c4,479,469Phasing windowAT5G13890c4,478,8434,480,928Family of unknown function (DUF716)
35c4,479,469Phasing windowath-MIR848c4,479,3974,479,591miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1434,877,516  9184488
C0F222,789,465  1147
d1F103,574,742  0000
d1F2123,705,660  361632
d234F1251,417,116  183588176
d234F2933,822,319  2449122243
r2F11232,195,923  56112280560
r2F22022,233,522  90181452904
r2FSb2985,728,276  52104260520
r2FNaSb1755,311,047  3366165330
r2FNa11011,834,656  55110275551
r2FNa21776,081,068  2958146291
r2FL601,145,942  52105262524
r2FD2154,928,142  4487218436
C0FCSb299,399,678  361531
C0FSb659,361,008  7143569
r2SC1243,743,342  6133264
r2SH222,165,395  102051102
r2SNa132,082,930  13714
r2SC3403,997,922  102050100
r2SNa2904,617,795  193997195
r2SSb493,278,680  153075149
r2SNaSb423,087,212  142768136
r2SC27476,105  152974147
r2SP203976,646  2084161,0392,079
C0RC141,249,181  361632
C0RNi101,211,490  8174183
AtCM1014,488,208  1137
AT_Leaf228,047,907  351427
At_miR1507OX_161,478,373  482041
At_miR1507OX_251,638,916  361531
At_miR2109OX_161,760,055  371734
At_miR2109OX_272,446,954  361429
At_miR2118aOX_151,212,493  482141
At_miR2118aOX_221,258,140  23816
At_miR2118bOX_162,023,619  361530
At_miR2118bOX_241,733,586  251223
At_miR2118cOX_151,995,522  351325
At_miR2118cOX_222,496,180  1248
At_miROX_control51,838,508  351427
At_miROX_ck_211,804,409  1136
hen1-825,456,831  1124
hen1-8 ntp2-156,244,400  1248
hen1-8 urt1-146,081,292  1137
hen1-8 ntp4-154,626,878  12511
hen1-8 ntp5-195,676,073  23816
hen1-8 ntp6-1434,328,718  10205099
hen1-8 ntp7-134,409,080  1137
hen1-8 ntp8-158,736,008  1136
hen1-8 ntp10-116,387,459  1112
hen1-8 r222,874,203  1137
hen1-8 heso1-146,015,054  1137
hen1-8 mee4433,435,030  1249
Wt_d1127,517,450  153074149
Col_d2611,692,099  241122


Link to FindMiRNA for this sequence