Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGAGAGAAGTGAGATGAAATC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
12w15,611,873Phasing windowAT2G37160w15,608,82715,612,934unknown function

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
22w15,611,873Phasing windowath-MIR1886w15,611,87015,611,982miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F114,877,516  1112
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F283,822,319  241021
r2F142,195,923  24918
r2F2102,233,522  492245
r2FSb355,728,276  6123161
r2FNaSb285,311,047  5112653
r2FNa121,834,656  12511
r2FNa2276,081,068  492244
r2FL11,145,942  1249
r2FD294,928,142  6122959
C0FCSb09,399,678  0000
C0FSb69,361,008  1136
r2SC123,743,342  1135
r2SH72,165,395  361632
r2SNa102,082,930  0000
r2SC3153,997,922  481938
r2SNa264,617,795  13613
r2SSb43,278,680  12612
r2SNaSb53,087,212  23816
r2SC20476,105  0000
r2SP11976,646  112356113
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM014,488,208  0000
AT_Leaf58,047,907  1136
At_miR1507OX_101,478,373  0000
At_miR1507OX_221,638,916  12612
At_miR2109OX_121,760,055  12611
At_miR2109OX_222,446,954  1248
At_miR2118aOX_111,212,493  1248
At_miR2118aOX_221,258,140  23816
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_121,995,522  12510
At_miR2118cOX_232,496,180  12612
At_miROX_control11,838,508  1135
At_miROX_ck_211,804,409  1136
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-136,081,292  1125
hen1-8 ntp4-114,626,878  1112
hen1-8 ntp5-175,676,073  12612
hen1-8 ntp6-1284,328,718  6133265
hen1-8 ntp7-144,409,080  1259
hen1-8 ntp8-148,736,008  1125
hen1-8 ntp10-136,387,459  1125
hen1-8 r212,874,203  1123
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d27,517,450  1113
Col_d1111,692,099  1259


Link to FindMiRNA for this sequence