Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TGAGATGAAATCTTTGATTGG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	15,611,882	Phasing window	AT2G37160	w	15,608,827	15,612,934	unknown function

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	w	15,611,882	Phasing window	ath-MIR1886	w	15,611,870	15,611,982	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	106	4,877,516	22	43	109	217
C0F2	3	2,789,465	1	2	5	11
d1F1	47	3,574,742	13	26	66	131
d1F2	29	3,705,660	8	16	39	78
d234F1	92	1,417,116	65	130	325	649
d234F2	177	3,822,319	46	93	232	463
r2F1	280	2,195,923	128	255	638	1,275
r2F2	98	2,233,522	44	88	219	439
r2FSb	339	5,728,276	59	118	296	592
r2FNaSb	239	5,311,047	45	90	225	450
r2FNa1	190	1,834,656	104	207	518	1,036
r2FNa2	377	6,081,068	62	124	310	620
r2FL	122	1,145,942	106	213	532	1,065
r2FD	303	4,928,142	61	123	307	615
C0FCSb	31	9,399,678	3	7	16	33
C0FSb	67	9,361,008	7	14	36	72
r2SC1	50	3,743,342	13	27	67	134
r2SH	51	2,165,395	24	47	118	236
r2SNa1	9	2,082,930	4	9	22	43
r2SC3	122	3,997,922	31	61	153	305
r2SNa2	31	4,617,795	7	13	34	67
r2SSb	29	3,278,680	9	18	44	88
r2SNaSb	103	3,087,212	33	67	167	334
r2SC2	6	476,105	13	25	63	126
r2SP	0	976,646	0	0	0	0
C0RC1	32	1,249,181	26	51	128	256
C0RNi	39	1,211,490	32	64	161	322
AtCM	93	14,488,208	6	13	32	64
AT_Leaf	630	8,047,907	78	157	391	783
At_miR1507OX_1	23	1,478,373	16	31	78	156
At_miR1507OX_2	43	1,638,916	26	52	131	262
At_miR2109OX_1	35	1,760,055	20	40	99	199
At_miR2109OX_2	58	2,446,954	24	47	119	237
At_miR2118aOX_1	23	1,212,493	19	38	95	190
At_miR2118aOX_2	42	1,258,140	33	67	167	334
At_miR2118bOX_1	43	2,023,619	21	42	106	212
At_miR2118bOX_2	32	1,733,586	18	37	92	185
At_miR2118cOX_1	57	1,995,522	29	57	143	286
At_miR2118cOX_2	46	2,496,180	18	37	92	184
At_miROX_control	59	1,838,508	32	64	160	321
At_miROX_ck_2	31	1,804,409	17	34	86	172
hen1-8	186	5,456,831	34	68	170	341
hen1-8 ntp2-1	280	6,244,400	45	90	224	448
hen1-8 urt1-1	322	6,081,292	53	106	265	529
hen1-8 ntp4-1	170	4,626,878	37	73	184	367
hen1-8 ntp5-1	382	5,676,073	67	135	337	673
hen1-8 ntp6-1	882	4,328,718	204	408	1,019	2,038
hen1-8 ntp7-1	193	4,409,080	44	88	219	438
hen1-8 ntp8-1	285	8,736,008	33	65	163	326
hen1-8 ntp10-1	231	6,387,459	36	72	181	362
hen1-8 r2	125	2,874,203	43	87	217	435
hen1-8 heso1-1	183	6,015,054	30	61	152	304
hen1-8 mee44	98	3,435,030	29	57	143	285
Wt_d	263	7,517,450	35	70	175	350
Col_d	203	11,692,099	17	35	87	174

Link to FindMiRNA for this sequence