Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGATCTCTTCGTACTCTTCTTG
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
12w10,247,390Phasing windowAT2G24103w10,247,20610,247,462MIR831a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
22w10,247,390Phasing windowath-MIR831w10,247,20610,247,462miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F114,877,516  1112
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F111,417,116  1147
d234F293,822,319  251224
r2F172,195,923  361632
r2F242,233,522  24918
r2FSb115,728,276  241019
r2FNaSb65,311,047  12611
r2FNa141,834,656  241122
r2FNa2136,081,068  241121
r2FL11,145,942  1249
r2FD134,928,142  351326
C0FCSb09,399,678  0000
C0FSb19,361,008  1111
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC323,997,922  1135
r2SNa224,617,795  1124
r2SSb13,278,680  1123
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP0976,646  0000
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM214,488,208  1111
AT_Leaf08,047,907  0000
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-825,456,831  1124
hen1-8 ntp2-136,244,400  1125
hen1-8 urt1-126,081,292  1123
hen1-8 ntp4-144,626,878  1249
hen1-8 ntp5-195,676,073  23816
hen1-8 ntp6-1314,328,718  7143672
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-188,736,008  1259
hen1-8 ntp10-136,387,459  1125
hen1-8 r272,874,203  251224
hen1-8 heso1-196,015,054  13715
hen1-8 mee4433,435,030  1249
Wt_d47,517,450  1135
Col_d811,692,099  1137


Link to FindMiRNA for this sequence