Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGATTCTCTGTGTAAGCGAAA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
13w8,236,227Phasing windowAT3G23125w8,236,1618,236,246miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
23w8,236,227Phasing windowath-MIR173w8,236,1538,236,254miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F11394,877,516  2857142285
C0F232,789,465  12511
d1F113,574,742  1113
d1F213,705,660  1113
d234F11191,417,116  84168420840
d234F21073,822,319  2856140280
r2F14272,195,923  1943899721,945
r2F21132,233,522  51101253506
r2FSb8175,728,276  1432857131,426
r2FNaSb4265,311,047  80160401802
r2FNa12891,834,656  1583157881,575
r2FNa26486,081,068  1072135331,066
r2FL2621,145,942  2294571,1432,286
r2FD5494,928,142  1112235571,114
C0FCSb389,399,678  482040
C0FSb1279,361,008  142768136
r2SC11563,743,342  4283208417
r2SH4402,165,395  2034061,0162,032
r2SNa1322,082,930  153177154
r2SC31023,997,922  2651128255
r2SNa2804,617,795  173587173
r2SSb1363,278,680  4183207415
r2SNaSb773,087,212  2550125249
r2SC274476,105  1553117771,554
r2SP15976,646  153177154
C0RC12701,249,181  2164321,0812,161
C0RNi2351,211,490  1943889701,940
AtCM3814,488,208  351326
AT_Leaf548,047,907  7133467
At_miR1507OX_111,478,373  1137
At_miR1507OX_221,638,916  12612
At_miR2109OX_101,760,055  0000
At_miR2109OX_212,446,954  1124
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_221,258,140  23816
At_miR2118bOX_122,023,619  12510
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_121,995,522  12510
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_211,804,409  1136
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-124,626,878  1124
hen1-8 ntp5-125,676,073  1124
hen1-8 ntp6-164,328,718  13714
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-116,015,054  1112
hen1-8 mee4403,435,030  0000
Wt_d2707,517,450  3672180359
Col_d611,692,099  1135


Link to FindMiRNA for this sequence