Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TGATTGAGCCGCGCCAATATC
Length: 21 nucleotides
Number of hits: 4

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	18,619,128	Phasing window	AT2G45160	c	18,617,862	18,620,150	unknown function

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	3	w	19,073,521	Phasing window	AT3G51375	w	19,073,450	19,073,541	MIR171A; miRNA
3	3	w	19,073,521	Phasing window	ath-MIR171a	w	19,073,434	19,073,556	miRNA
4	3	w	22,411,544	Phasing window	AT3G60630	c	22,410,365	22,412,608	GRAS family transcription factor
5	4	w	58,411	Phasing window	AT4G00150	c	57,199	59,286	GRAS family transcription factor

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	1,288	4,877,516	264	528	1,320	2,641
C0F2	38	2,789,465	14	27	68	136
d1F1	49	3,574,742	14	27	69	137
d1F2	30	3,705,660	8	16	40	81
d234F1	835	1,417,116	589	1,178	2,946	5,892
d234F2	597	3,822,319	156	312	781	1,562
r2F1	3,359	2,195,923	1,530	3,059	7,648	15,297
r2F2	108	2,233,522	48	97	242	484
r2FSb	8,721	5,728,276	1,522	3,045	7,612	15,224
r2FNaSb	5,176	5,311,047	975	1,949	4,873	9,746
r2FNa1	3,843	1,834,656	2,095	4,189	10,473	20,947
r2FNa2	2,277	6,081,068	374	749	1,872	3,744
r2FL	1,379	1,145,942	1,203	2,407	6,017	12,034
r2FD	5,183	4,928,142	1,052	2,103	5,259	10,517
C0FCSb	96	9,399,678	10	20	51	102
C0FSb	748	9,361,008	80	160	400	799
r2SC1	228	3,743,342	61	122	305	609
r2SH	669	2,165,395	309	618	1,545	3,090
r2SNa1	23	2,082,930	11	22	55	110
r2SC3	966	3,997,922	242	483	1,208	2,416
r2SNa2	2,038	4,617,795	441	883	2,207	4,413
r2SSb	1,962	3,278,680	598	1,197	2,992	5,984
r2SNaSb	1,181	3,087,212	383	765	1,913	3,825
r2SC2	344	476,105	723	1,445	3,613	7,225
r2SP	7,749	976,646	7,934	15,869	39,671	79,343
C0RC1	5	1,249,181	4	8	20	40
C0RNi	2	1,211,490	2	3	8	17
AtCM	4,449	14,488,208	307	614	1,535	3,071
AT_Leaf	340	8,047,907	42	84	211	422
At_miR1507OX_1	59	1,478,373	40	80	200	399
At_miR1507OX_2	145	1,638,916	88	177	442	885
At_miR2109OX_1	70	1,760,055	40	80	199	398
At_miR2109OX_2	148	2,446,954	60	121	302	605
At_miR2118aOX_1	56	1,212,493	46	92	231	462
At_miR2118aOX_2	76	1,258,140	60	121	302	604
At_miR2118bOX_1	168	2,023,619	83	166	415	830
At_miR2118bOX_2	103	1,733,586	59	119	297	594
At_miR2118cOX_1	96	1,995,522	48	96	241	481
At_miR2118cOX_2	120	2,496,180	48	96	240	481
At_miROX_control	154	1,838,508	84	168	419	838
At_miROX_ck_2	178	1,804,409	99	197	493	986
hen1-8	146	5,456,831	27	54	134	268
hen1-8 ntp2-1	128	6,244,400	20	41	102	205
hen1-8 urt1-1	577	6,081,292	95	190	474	949
hen1-8 ntp4-1	154	4,626,878	33	67	166	333
hen1-8 ntp5-1	273	5,676,073	48	96	240	481
hen1-8 ntp6-1	1,339	4,328,718	309	619	1,547	3,093
hen1-8 ntp7-1	157	4,409,080	36	71	178	356
hen1-8 ntp8-1	304	8,736,008	35	70	174	348
hen1-8 ntp10-1	159	6,387,459	25	50	124	249
hen1-8 r2	76	2,874,203	26	53	132	264
hen1-8 heso1-1	137	6,015,054	23	46	114	228
hen1-8 mee44	83	3,435,030	24	48	121	242
Wt_d	22,428	7,517,450	2,983	5,967	14,917	29,835
Col_d	1,083	11,692,099	93	185	463	926

Link to FindMiRNA for this sequence