Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TGATTGAGCCGTGTCAATATC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	5	c	26,411,614	Phasing window	AT5G66045	c	26,411,594	26,411,657	MIR170; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	5	c	26,411,614	Phasing window	ath-MIR170	c	26,411,580	26,411,672	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	50	4,877,516	10	21	51	103
C0F2	3	2,789,465	1	2	5	11
d1F1	1	3,574,742	1	1	1	3
d1F2	0	3,705,660	0	0	0	0
d234F1	3	1,417,116	2	4	11	21
d234F2	5	3,822,319	1	3	7	13
r2F1	137	2,195,923	62	125	312	624
r2F2	9	2,233,522	4	8	20	40
r2FSb	365	5,728,276	64	127	319	637
r2FNaSb	208	5,311,047	39	78	196	392
r2FNa1	42	1,834,656	23	46	114	229
r2FNa2	162	6,081,068	27	53	133	266
r2FL	76	1,145,942	66	133	332	663
r2FD	229	4,928,142	46	93	232	465
C0FCSb	12	9,399,678	1	3	6	13
C0FSb	33	9,361,008	4	7	18	35
r2SC1	11	3,743,342	3	6	15	29
r2SH	120	2,165,395	55	111	277	554
r2SNa1	0	2,082,930	0	0	0	0
r2SC3	44	3,997,922	11	22	55	110
r2SNa2	58	4,617,795	13	25	63	126
r2SSb	123	3,278,680	38	75	188	375
r2SNaSb	79	3,087,212	26	51	128	256
r2SC2	77	476,105	162	323	809	1,617
r2SP	238	976,646	244	487	1,218	2,437
C0RC1	22	1,249,181	18	35	88	176
C0RNi	10	1,211,490	8	17	41	83
AtCM	46	14,488,208	3	6	16	32
AT_Leaf	56	8,047,907	7	14	35	70
At_miR1507OX_1	7	1,478,373	5	9	24	47
At_miR1507OX_2	6	1,638,916	4	7	18	37
At_miR2109OX_1	7	1,760,055	4	8	20	40
At_miR2109OX_2	16	2,446,954	7	13	33	65
At_miR2118aOX_1	7	1,212,493	6	12	29	58
At_miR2118aOX_2	8	1,258,140	6	13	32	64
At_miR2118bOX_1	13	2,023,619	6	13	32	64
At_miR2118bOX_2	5	1,733,586	3	6	14	29
At_miR2118cOX_1	16	1,995,522	8	16	40	80
At_miR2118cOX_2	16	2,496,180	6	13	32	64
At_miROX_control	13	1,838,508	7	14	35	71
At_miROX_ck_2	12	1,804,409	7	13	33	67
hen1-8	19	5,456,831	3	7	17	35
hen1-8 ntp2-1	13	6,244,400	2	4	10	21
hen1-8 urt1-1	67	6,081,292	11	22	55	110
hen1-8 ntp4-1	25	4,626,878	5	11	27	54
hen1-8 ntp5-1	26	5,676,073	5	9	23	46
hen1-8 ntp6-1	148	4,328,718	34	68	171	342
hen1-8 ntp7-1	23	4,409,080	5	10	26	52
hen1-8 ntp8-1	39	8,736,008	4	9	22	45
hen1-8 ntp10-1	18	6,387,459	3	6	14	28
hen1-8 r2	24	2,874,203	8	17	42	84
hen1-8 heso1-1	18	6,015,054	3	6	15	30
hen1-8 mee44	14	3,435,030	4	8	20	41
Wt_d	392	7,517,450	52	104	261	521
Col_d	41	11,692,099	4	7	18	35

Link to FindMiRNA for this sequence