Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TGATTGGAAATTTCGTTGACT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	9,560,866	Phasing window	AT2G22496	w	9,560,761	9,560,923	MIR779a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	w	9,560,866	Phasing window	ath-MIR779	w	9,560,761	9,560,923	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	3	4,877,516	1	1	3	6
C0F2	7	2,789,465	3	5	13	25
d1F1	0	3,574,742	0	0	0	0
d1F2	0	3,705,660	0	0	0	0
d234F1	2	1,417,116	1	3	7	14
d234F2	72	3,822,319	19	38	94	188
r2F1	24	2,195,923	11	22	55	109
r2F2	107	2,233,522	48	96	240	479
r2FSb	44	5,728,276	8	15	38	77
r2FNaSb	47	5,311,047	9	18	44	88
r2FNa1	5	1,834,656	3	5	14	27
r2FNa2	80	6,081,068	13	26	66	132
r2FL	35	1,145,942	31	61	153	305
r2FD	51	4,928,142	10	21	52	103
C0FCSb	2	9,399,678	1	1	1	2
C0FSb	2	9,361,008	1	1	1	2
r2SC1	6	3,743,342	2	3	8	16
r2SH	7	2,165,395	3	6	16	32
r2SNa1	0	2,082,930	0	0	0	0
r2SC3	18	3,997,922	5	9	23	45
r2SNa2	7	4,617,795	2	3	8	15
r2SSb	7	3,278,680	2	4	11	21
r2SNaSb	15	3,087,212	5	10	24	49
r2SC2	47	476,105	99	197	494	987
r2SP	9	976,646	9	18	46	92
C0RC1	4	1,249,181	3	6	16	32
C0RNi	1	1,211,490	1	2	4	8
AtCM	3	14,488,208	1	1	1	2
AT_Leaf	72	8,047,907	9	18	45	89
At_miR1507OX_1	5	1,478,373	3	7	17	34
At_miR1507OX_2	22	1,638,916	13	27	67	134
At_miR2109OX_1	5	1,760,055	3	6	14	28
At_miR2109OX_2	9	2,446,954	4	7	18	37
At_miR2118aOX_1	9	1,212,493	7	15	37	74
At_miR2118aOX_2	13	1,258,140	10	21	52	103
At_miR2118bOX_1	17	2,023,619	8	17	42	84
At_miR2118bOX_2	10	1,733,586	6	12	29	58
At_miR2118cOX_1	13	1,995,522	7	13	33	65
At_miR2118cOX_2	21	2,496,180	8	17	42	84
At_miROX_control	19	1,838,508	10	21	52	103
At_miROX_ck_2	21	1,804,409	12	23	58	116
hen1-8	529	5,456,831	97	194	485	969
hen1-8 ntp2-1	614	6,244,400	98	197	492	983
hen1-8 urt1-1	727	6,081,292	120	239	598	1,195
hen1-8 ntp4-1	474	4,626,878	102	205	512	1,024
hen1-8 ntp5-1	987	5,676,073	174	348	869	1,739
hen1-8 ntp6-1	5,210	4,328,718	1,204	2,407	6,018	12,036
hen1-8 ntp7-1	521	4,409,080	118	236	591	1,182
hen1-8 ntp8-1	861	8,736,008	99	197	493	986
hen1-8 ntp10-1	623	6,387,459	98	195	488	975
hen1-8 r2	364	2,874,203	127	253	633	1,266
hen1-8 heso1-1	442	6,015,054	73	147	367	735
hen1-8 mee44	366	3,435,030	107	213	533	1,065
Wt_d	9	7,517,450	1	2	6	12
Col_d	274	11,692,099	23	47	117	234

Link to FindMiRNA for this sequence