Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGCCAAAGGAGATTTGCCCGG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
12w14,445,084Phasing windowAT2G34208w14,444,99714,445,114miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
22w14,445,084Phasing windowath-MIR399fw14,444,99714,445,114miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F114,877,516  1112
C0F202,789,465  0000
d1F103,574,742  0000
d1F213,705,660  1113
d234F141,417,116  361428
d234F213,822,319  1113
r2F1102,195,923  592346
r2F222,233,522  1249
r2FSb85,728,276  13714
r2FNaSb115,311,047  241021
r2FNa141,834,656  241122
r2FNa236,081,068  1125
r2FL01,145,942  0000
r2FD24,928,142  1124
C0FCSb29,399,678  1112
C0FSb39,361,008  1123
r2SC1943,743,342  2550126251
r2SH62,165,395  361428
r2SNa102,082,930  0000
r2SC3723,997,922  183690180
r2SNa21174,617,795  2551127253
r2SSb1533,278,680  4793233467
r2SNaSb573,087,212  183792185
r2SC221476,105  4488221441
r2SP20,304976,646  20,79041,579103,948207,895
C0RC1391,249,181  3162156312
C0RNi1081,211,490  89178446891
AtCM214,488,208  1111
AT_Leaf1658,047,907  2141103205
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_212,496,180  1124
At_miROX_control01,838,508  0000
At_miROX_ck_221,804,409  12611
hen1-805,456,831  0000
hen1-8 ntp2-186,244,400  13613
hen1-8 urt1-146,081,292  1137
hen1-8 ntp4-124,626,878  1124
hen1-8 ntp5-115,676,073  1112
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r242,874,203  13714
hen1-8 heso1-186,015,054  13713
hen1-8 mee4433,435,030  1249
Wt_d87,517,450  12511
Col_d011,692,099  0000


Link to FindMiRNA for this sequence