Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGCCAAAGGAGATTTGCCCTG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w10,227,165Phasing windowAT1G29265w10,227,07310,227,195MIR399A; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w10,227,165Phasing windowath-MIR399aw10,227,07310,227,195miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F134,877,516  1136
C0F202,789,465  0000
d1F103,574,742  0000
d1F213,705,660  1113
d234F111,417,116  1147
d234F223,822,319  1135
r2F122,195,923  1259
r2F232,233,522  13713
r2FSb105,728,276  23917
r2FNaSb75,311,047  13713
r2FNa151,834,656  351427
r2FNa2156,081,068  251225
r2FL11,145,942  1249
r2FD164,928,142  361632
C0FCSb09,399,678  0000
C0FSb19,361,008  1111
r2SC1343,743,342  9184591
r2SH32,165,395  13714
r2SNa102,082,930  0000
r2SC3653,997,922  163381163
r2SNa2694,617,795  153075149
r2SSb1383,278,680  4284210421
r2SNaSb553,087,212  183689178
r2SC25476,105  112153105
r2SP666976,646  6821,3643,4106,819
C0RC1111,249,181  9184488
C0RNi481,211,490  4079198396
AtCM1314,488,208  1249
AT_Leaf18,047,907  1111
At_miR1507OX_111,478,373  1137
At_miR1507OX_241,638,916  251224
At_miR2109OX_151,760,055  361428
At_miR2109OX_252,446,954  241020
At_miR2118aOX_141,212,493  371633
At_miR2118aOX_231,258,140  251224
At_miR2118bOX_112,023,619  1125
At_miR2118bOX_251,733,586  361429
At_miR2118cOX_151,995,522  351325
At_miR2118cOX_222,496,180  1248
At_miROX_control11,838,508  1135
At_miROX_ck_241,804,409  241122
hen1-8795,456,831  142972145
hen1-8 ntp2-11516,244,400  2448121242
hen1-8 urt1-11236,081,292  2040101202
hen1-8 ntp4-1554,626,878  122459119
hen1-8 ntp5-1385,676,073  7133367
hen1-8 ntp6-11664,328,718  3877192383
hen1-8 ntp7-1554,409,080  122562125
hen1-8 ntp8-1778,736,008  9184488
hen1-8 ntp10-1396,387,459  6123161
hen1-8 r2522,874,203  183690181
hen1-8 heso1-11736,015,054  2958144288
hen1-8 mee44673,435,030  203998195
Wt_d87,517,450  12511
Col_d4511,692,099  481938


Link to FindMiRNA for this sequence