Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TGCGGGAAGCATTTGCACATG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	5	c	897,307	Phasing window	AT5G03552	c	897,020	897,356	MIR822a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	5	c	897,307	Phasing window	ath-MIR822	c	897,020	897,356	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	215	4,877,516	44	88	220	441
C0F2	76	2,789,465	27	54	136	272
d1F1	117	3,574,742	33	65	164	327
d1F2	55	3,705,660	15	30	74	148
d234F1	6	1,417,116	4	8	21	42
d234F2	1	3,822,319	1	1	1	3
r2F1	913	2,195,923	416	832	2,079	4,158
r2F2	495	2,233,522	222	443	1,108	2,216
r2FSb	4,476	5,728,276	781	1,563	3,907	7,814
r2FNaSb	3,654	5,311,047	688	1,376	3,440	6,880
r2FNa1	1,187	1,834,656	647	1,294	3,235	6,470
r2FNa2	5,138	6,081,068	845	1,690	4,225	8,449
r2FL	443	1,145,942	387	773	1,933	3,866
r2FD	2,051	4,928,142	416	832	2,081	4,162
C0FCSb	15	9,399,678	2	3	8	16
C0FSb	112	9,361,008	12	24	60	120
r2SC1	1,566	3,743,342	418	837	2,092	4,183
r2SH	1,403	2,165,395	648	1,296	3,240	6,479
r2SNa1	144	2,082,930	69	138	346	691
r2SC3	2,198	3,997,922	550	1,100	2,749	5,498
r2SNa2	2,639	4,617,795	571	1,143	2,857	5,715
r2SSb	1,758	3,278,680	536	1,072	2,681	5,362
r2SNaSb	1,569	3,087,212	508	1,016	2,541	5,082
r2SC2	277	476,105	582	1,164	2,909	5,818
r2SP	5,462	976,646	5,593	11,185	27,963	55,926
C0RC1	1,203	1,249,181	963	1,926	4,815	9,630
C0RNi	3,482	1,211,490	2,874	5,748	14,371	28,741
AtCM	323	14,488,208	22	45	111	223
AT_Leaf	1,702	8,047,907	211	423	1,057	2,115
At_miR1507OX_1	57	1,478,373	39	77	193	386
At_miR1507OX_2	148	1,638,916	90	181	452	903
At_miR2109OX_1	60	1,760,055	34	68	170	341
At_miR2109OX_2	153	2,446,954	63	125	313	625
At_miR2118aOX_1	62	1,212,493	51	102	256	511
At_miR2118aOX_2	117	1,258,140	93	186	465	930
At_miR2118bOX_1	209	2,023,619	103	207	516	1,033
At_miR2118bOX_2	83	1,733,586	48	96	239	479
At_miR2118cOX_1	140	1,995,522	70	140	351	702
At_miR2118cOX_2	161	2,496,180	64	129	322	645
At_miROX_control	115	1,838,508	63	125	313	626
At_miROX_ck_2	148	1,804,409	82	164	410	820
hen1-8	56	5,456,831	10	21	51	103
hen1-8 ntp2-1	37	6,244,400	6	12	30	59
hen1-8 urt1-1	30	6,081,292	5	10	25	49
hen1-8 ntp4-1	65	4,626,878	14	28	70	140
hen1-8 ntp5-1	68	5,676,073	12	24	60	120
hen1-8 ntp6-1	276	4,328,718	64	128	319	638
hen1-8 ntp7-1	44	4,409,080	10	20	50	100
hen1-8 ntp8-1	78	8,736,008	9	18	45	89
hen1-8 ntp10-1	42	6,387,459	7	13	33	66
hen1-8 r2	35	2,874,203	12	24	61	122
hen1-8 heso1-1	113	6,015,054	19	38	94	188
hen1-8 mee44	68	3,435,030	20	40	99	198
Wt_d	484	7,517,450	64	129	322	644
Col_d	162	11,692,099	14	28	69	139

Link to FindMiRNA for this sequence