Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TGCTCACCTCTCTTTCTGTCAGT
Length: 23 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	4	w	15,075,004	Phasing window	AT4G30972	w	15,074,945	15,075,024	MIR156B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	4	w	15,075,004	Phasing window	ath-MIR156b	w	15,074,899	15,075,081	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	0	4,877,516	0	0	0	0
C0F2	2	2,789,465	1	1	4	7
d1F1	0	3,574,742	0	0	0	0
d1F2	0	3,705,660	0	0	0	0
d234F1	3	1,417,116	2	4	11	21
d234F2	22	3,822,319	6	12	29	58
r2F1	13	2,195,923	6	12	30	59
r2F2	28	2,233,522	13	25	63	125
r2FSb	15	5,728,276	3	5	13	26
r2FNaSb	12	5,311,047	2	5	11	23
r2FNa1	7	1,834,656	4	8	19	38
r2FNa2	6	6,081,068	1	2	5	10
r2FL	6	1,145,942	5	10	26	52
r2FD	24	4,928,142	5	10	24	49
C0FCSb	1	9,399,678	1	1	1	1
C0FSb	1	9,361,008	1	1	1	1
r2SC1	62	3,743,342	17	33	83	166
r2SH	16	2,165,395	7	15	37	74
r2SNa1	0	2,082,930	0	0	0	0
r2SC3	8	3,997,922	2	4	10	20
r2SNa2	47	4,617,795	10	20	51	102
r2SSb	35	3,278,680	11	21	53	107
r2SNaSb	14	3,087,212	5	9	23	45
r2SC2	130	476,105	273	546	1,365	2,730
r2SP	14	976,646	14	29	72	143
C0RC1	2,745	1,249,181	2,197	4,395	10,987	21,974
C0RNi	968	1,211,490	799	1,598	3,995	7,990
AtCM	65	14,488,208	4	9	22	45
AT_Leaf	1,078	8,047,907	134	268	670	1,339
At_miR1507OX_1	20	1,478,373	14	27	68	135
At_miR1507OX_2	35	1,638,916	21	43	107	214
At_miR2109OX_1	26	1,760,055	15	30	74	148
At_miR2109OX_2	72	2,446,954	29	59	147	294
At_miR2118aOX_1	14	1,212,493	12	23	58	115
At_miR2118aOX_2	28	1,258,140	22	45	111	223
At_miR2118bOX_1	56	2,023,619	28	55	138	277
At_miR2118bOX_2	33	1,733,586	19	38	95	190
At_miR2118cOX_1	43	1,995,522	22	43	108	215
At_miR2118cOX_2	62	2,496,180	25	50	124	248
At_miROX_control	32	1,838,508	17	35	87	174
At_miROX_ck_2	18	1,804,409	10	20	50	100
hen1-8	2	5,456,831	1	1	2	4
hen1-8 ntp2-1	1	6,244,400	1	1	1	2
hen1-8 urt1-1	0	6,081,292	0	0	0	0
hen1-8 ntp4-1	0	4,626,878	0	0	0	0
hen1-8 ntp5-1	2	5,676,073	1	1	2	4
hen1-8 ntp6-1	18	4,328,718	4	8	21	42
hen1-8 ntp7-1	0	4,409,080	0	0	0	0
hen1-8 ntp8-1	1	8,736,008	1	1	1	1
hen1-8 ntp10-1	2	6,387,459	1	1	2	3
hen1-8 r2	1	2,874,203	1	1	2	3
hen1-8 heso1-1	0	6,015,054	0	0	0	0
hen1-8 mee44	0	3,435,030	0	0	0	0
Wt_d	20	7,517,450	3	5	13	27
Col_d	79	11,692,099	7	14	34	68

Link to FindMiRNA for this sequence