Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGGAAGAAGGTGAGACTTGCA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
14c6,791,421Phasing windowath-MIR5020ac6,791,3016,791,470miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1334,877,516  7143468
C0F202,789,465  0000
d1F123,574,742  1136
d1F203,705,660  0000
d234F1161,417,116  112356113
d234F2523,822,319  142768136
r2F11002,195,923  4691228455
r2F2532,233,522  2447119237
r2FSb3005,728,276  52105262524
r2FNaSb2875,311,047  54108270540
r2FNa1431,834,656  2347117234
r2FNa21706,081,068  2856140280
r2FL431,145,942  3875188375
r2FD3444,928,142  70140349698
C0FCSb159,399,678  23816
C0FSb879,361,008  9194693
r2SC13,4723,743,342  9281,8554,6389,275
r2SH5,2232,165,395  2,4124,82412,06024,120
r2SNa12,4392,082,930  1,1712,3425,85511,709
r2SC32,5863,997,922  6471,2943,2346,468
r2SNa27,3074,617,795  1,5823,1657,91215,824
r2SSb1,9313,278,680  5891,1782,9455,890
r2SNaSb2,3443,087,212  7591,5193,7967,593
r2SC2190476,105  3997981,9953,991
r2SP767976,646  7851,5713,9277,853
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM814,488,208  1136
AT_Leaf08,047,907  0000
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d57,517,450  1137
Col_d011,692,099  0000


Link to FindMiRNA for this sequence