Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGGAAGATGCTTTGGGATTTATT
Length: 23 nucleotides
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w11,786,348Phasing windowAT1G32583w11,785,80611,788,286




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F114,877,516  1112
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F121,417,116  13714
d234F253,822,319  13713
r2F142,195,923  24918
r2F262,233,522  351327
r2FSb175,728,276  361530
r2FNaSb115,311,047  241021
r2FNa111,834,656  1135
r2FNa276,081,068  12612
r2FL21,145,942  23917
r2FD74,928,142  13714
C0FCSb19,399,678  1111
C0FSb09,361,008  0000
r2SC1243,743,342  6133264
r2SH32,165,395  13714
r2SNa122,082,930  12510
r2SC3343,997,922  9174385
r2SNa2714,617,795  153177154
r2SSb123,278,680  471837
r2SNaSb273,087,212  9174487
r2SC2142476,105  2985971,4912,983
r2SP181976,646  1853719271,853
C0RC13961,249,181  3176341,5853,170
C0RNi781,211,490  64129322644
AtCM014,488,208  0000
AT_Leaf1178,047,907  152973145
At_miR1507OX_101,478,373  0000
At_miR1507OX_211,638,916  1136
At_miR2109OX_101,760,055  0000
At_miR2109OX_212,446,954  1124
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_211,258,140  1248
At_miR2118bOX_112,023,619  1125
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_212,496,180  1124
At_miROX_control11,838,508  1135
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d57,517,450  1137
Col_d011,692,099  0000


Link to FindMiRNA for this sequence