Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TGGAGAAGCAGGGCACGTGCA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	19,520,770	Phasing window	AT2G47585	w	19,520,770	19,520,847	miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	w	19,520,770	Phasing window	ath-MIR164a	w	19,520,752	19,520,864	miRNA
3	5	w	287,586	Phasing window	AT5G01747	w	287,586	287,734	MIR164/MIR164B; miRNA
4	5	w	287,586	Phasing window	ath-MIR164b	w	287,584	287,736	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	1,956	4,877,516	401	802	2,005	4,010
C0F2	1,151	2,789,465	413	825	2,063	4,126
d1F1	561	3,574,742	157	314	785	1,569
d1F2	642	3,705,660	173	346	866	1,732
d234F1	4,569	1,417,116	3,224	6,448	16,121	32,242
d234F2	11,350	3,822,319	2,969	5,939	14,847	29,694
r2F1	5,393	2,195,923	2,456	4,912	12,280	24,559
r2F2	2,459	2,233,522	1,101	2,202	5,505	11,010
r2FSb	26,359	5,728,276	4,602	9,203	23,008	46,016
r2FNaSb	29,661	5,311,047	5,585	11,170	27,924	55,848
r2FNa1	1,344	1,834,656	733	1,465	3,663	7,326
r2FNa2	33,878	6,081,068	5,571	11,142	27,855	55,711
r2FL	1,526	1,145,942	1,332	2,663	6,658	13,317
r2FD	34,371	4,928,142	6,974	13,949	34,872	69,744
C0FCSb	428	9,399,678	46	91	228	455
C0FSb	3,149	9,361,008	336	673	1,682	3,364
r2SC1	7,522	3,743,342	2,009	4,019	10,047	20,094
r2SH	10,657	2,165,395	4,922	9,843	24,608	49,215
r2SNa1	1,058	2,082,930	508	1,016	2,540	5,079
r2SC3	7,718	3,997,922	1,931	3,861	9,653	19,305
r2SNa2	19,811	4,617,795	4,290	8,580	21,451	42,901
r2SSb	16,689	3,278,680	5,090	10,180	25,451	50,902
r2SNaSb	5,545	3,087,212	1,796	3,592	8,981	17,961
r2SC2	22	476,105	46	92	231	462
r2SP	553	976,646	566	1,132	2,831	5,662
C0RC1	317	1,249,181	254	508	1,269	2,538
C0RNi	291	1,211,490	240	480	1,201	2,402
AtCM	3,118	14,488,208	215	430	1,076	2,152
AT_Leaf	1,217	8,047,907	151	302	756	1,512
At_miR1507OX_1	32	1,478,373	22	43	108	216
At_miR1507OX_2	91	1,638,916	56	111	278	555
At_miR2109OX_1	43	1,760,055	24	49	122	244
At_miR2109OX_2	67	2,446,954	27	55	137	274
At_miR2118aOX_1	32	1,212,493	26	53	132	264
At_miR2118aOX_2	73	1,258,140	58	116	290	580
At_miR2118bOX_1	103	2,023,619	51	102	254	509
At_miR2118bOX_2	51	1,733,586	29	59	147	294
At_miR2118cOX_1	61	1,995,522	31	61	153	306
At_miR2118cOX_2	88	2,496,180	35	71	176	353
At_miROX_control	67	1,838,508	36	73	182	364
At_miROX_ck_2	108	1,804,409	60	120	299	599
hen1-8	9	5,456,831	2	3	8	16
hen1-8 ntp2-1	9	6,244,400	1	3	7	14
hen1-8 urt1-1	12	6,081,292	2	4	10	20
hen1-8 ntp4-1	10	4,626,878	2	4	11	22
hen1-8 ntp5-1	12	5,676,073	2	4	11	21
hen1-8 ntp6-1	68	4,328,718	16	31	79	157
hen1-8 ntp7-1	4	4,409,080	1	2	5	9
hen1-8 ntp8-1	10	8,736,008	1	2	6	11
hen1-8 ntp10-1	22	6,387,459	3	7	17	34
hen1-8 r2	0	2,874,203	0	0	0	0
hen1-8 heso1-1	6	6,015,054	1	2	5	10
hen1-8 mee44	4	3,435,030	1	2	6	12
Wt_d	3,934	7,517,450	523	1,047	2,617	5,233
Col_d	233	11,692,099	20	40	100	199

Link to FindMiRNA for this sequence