Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TGGAGAAGCAGGGCACGTGCG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	5	w	9,852,684	Phasing window	AT5G27807	w	9,852,664	9,852,783	MIR164/MIR164C; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	5	w	9,852,684	Phasing window	ath-MIR164c	w	9,852,674	9,852,775	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	76	4,877,516	16	31	78	156
C0F2	31	2,789,465	11	22	56	111
d1F1	43	3,574,742	12	24	60	120
d1F2	57	3,705,660	15	31	77	154
d234F1	93	1,417,116	66	131	328	656
d234F2	367	3,822,319	96	192	480	960
r2F1	237	2,195,923	108	216	540	1,079
r2F2	67	2,233,522	30	60	150	300
r2FSb	849	5,728,276	148	296	741	1,482
r2FNaSb	1,120	5,311,047	211	422	1,054	2,109
r2FNa1	87	1,834,656	47	95	237	474
r2FNa2	1,361	6,081,068	224	448	1,119	2,238
r2FL	43	1,145,942	38	75	188	375
r2FD	2,080	4,928,142	422	844	2,110	4,221
C0FCSb	17	9,399,678	2	4	9	18
C0FSb	110	9,361,008	12	24	59	118
r2SC1	1,027	3,743,342	274	549	1,372	2,744
r2SH	979	2,165,395	452	904	2,261	4,521
r2SNa1	80	2,082,930	38	77	192	384
r2SC3	864	3,997,922	216	432	1,081	2,161
r2SNa2	2,016	4,617,795	437	873	2,183	4,366
r2SSb	2,474	3,278,680	755	1,509	3,773	7,546
r2SNaSb	642	3,087,212	208	416	1,040	2,080
r2SC2	3	476,105	6	13	32	63
r2SP	122	976,646	125	250	625	1,249
C0RC1	5	1,249,181	4	8	20	40
C0RNi	1	1,211,490	1	2	4	8
AtCM	131	14,488,208	9	18	45	90
AT_Leaf	127	8,047,907	16	32	79	158
At_miR1507OX_1	1	1,478,373	1	1	3	7
At_miR1507OX_2	4	1,638,916	2	5	12	24
At_miR2109OX_1	2	1,760,055	1	2	6	11
At_miR2109OX_2	4	2,446,954	2	3	8	16
At_miR2118aOX_1	1	1,212,493	1	2	4	8
At_miR2118aOX_2	2	1,258,140	2	3	8	16
At_miR2118bOX_1	2	2,023,619	1	2	5	10
At_miR2118bOX_2	2	1,733,586	1	2	6	12
At_miR2118cOX_1	3	1,995,522	2	3	8	15
At_miR2118cOX_2	5	2,496,180	2	4	10	20
At_miROX_control	2	1,838,508	1	2	5	11
At_miROX_ck_2	0	1,804,409	0	0	0	0
hen1-8	0	5,456,831	0	0	0	0
hen1-8 ntp2-1	1	6,244,400	1	1	1	2
hen1-8 urt1-1	0	6,081,292	0	0	0	0
hen1-8 ntp4-1	0	4,626,878	0	0	0	0
hen1-8 ntp5-1	2	5,676,073	1	1	2	4
hen1-8 ntp6-1	6	4,328,718	1	3	7	14
hen1-8 ntp7-1	1	4,409,080	1	1	1	2
hen1-8 ntp8-1	0	8,736,008	0	0	0	0
hen1-8 ntp10-1	0	6,387,459	0	0	0	0
hen1-8 r2	0	2,874,203	0	0	0	0
hen1-8 heso1-1	0	6,015,054	0	0	0	0
hen1-8 mee44	0	3,435,030	0	0	0	0
Wt_d	267	7,517,450	36	71	178	355
Col_d	7	11,692,099	1	1	3	6

Link to FindMiRNA for this sequence