Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TGGAGGCAGCGGTTCATCGATC
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	5	c	2,635,019	Phasing window	AT5G08185	c	2,634,101	2,635,438	microRNA162A

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	5	c	2,635,019	Phasing window	ath-MIR162a	c	2,634,905	2,635,044	miRNA
3	5	c	7,740,696	Phasing window	AT5G23065	c	7,740,610	7,740,697	MIR162B; miRNA
4	5	c	7,740,696	Phasing window	ath-MIR162b	c	7,740,598	7,740,708	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	41	4,877,516	8	17	42	84
C0F2	3	2,789,465	1	2	5	11
d1F1	9	3,574,742	3	5	13	25
d1F2	17	3,705,660	5	9	23	46
d234F1	54	1,417,116	38	76	191	381
d234F2	197	3,822,319	52	103	258	515
r2F1	98	2,195,923	45	89	223	446
r2F2	69	2,233,522	31	62	154	309
r2FSb	248	5,728,276	43	87	216	433
r2FNaSb	222	5,311,047	42	84	209	418
r2FNa1	97	1,834,656	53	106	264	529
r2FNa2	129	6,081,068	21	42	106	212
r2FL	37	1,145,942	32	65	161	323
r2FD	414	4,928,142	84	168	420	840
C0FCSb	66	9,399,678	7	14	35	70
C0FSb	77	9,361,008	8	16	41	82
r2SC1	54	3,743,342	14	29	72	144
r2SH	19	2,165,395	9	18	44	88
r2SNa1	1	2,082,930	1	1	2	5
r2SC3	62	3,997,922	16	31	78	155
r2SNa2	117	4,617,795	25	51	127	253
r2SSb	94	3,278,680	29	57	143	287
r2SNaSb	66	3,087,212	21	43	107	214
r2SC2	5	476,105	11	21	53	105
r2SP	32	976,646	33	66	164	328
C0RC1	21	1,249,181	17	34	84	168
C0RNi	15	1,211,490	12	25	62	124
AtCM	38	14,488,208	3	5	13	26
AT_Leaf	20	8,047,907	2	5	12	25
At_miR1507OX_1	2	1,478,373	1	3	7	14
At_miR1507OX_2	4	1,638,916	2	5	12	24
At_miR2109OX_1	2	1,760,055	1	2	6	11
At_miR2109OX_2	7	2,446,954	3	6	14	29
At_miR2118aOX_1	0	1,212,493	0	0	0	0
At_miR2118aOX_2	5	1,258,140	4	8	20	40
At_miR2118bOX_1	9	2,023,619	4	9	22	44
At_miR2118bOX_2	2	1,733,586	1	2	6	12
At_miR2118cOX_1	5	1,995,522	3	5	13	25
At_miR2118cOX_2	7	2,496,180	3	6	14	28
At_miROX_control	2	1,838,508	1	2	5	11
At_miROX_ck_2	2	1,804,409	1	2	6	11
hen1-8	1	5,456,831	1	1	1	2
hen1-8 ntp2-1	2	6,244,400	1	1	2	3
hen1-8 urt1-1	3	6,081,292	1	1	2	5
hen1-8 ntp4-1	2	4,626,878	1	1	2	4
hen1-8 ntp5-1	6	5,676,073	1	2	5	11
hen1-8 ntp6-1	17	4,328,718	4	8	20	39
hen1-8 ntp7-1	0	4,409,080	0	0	0	0
hen1-8 ntp8-1	4	8,736,008	1	1	2	5
hen1-8 ntp10-1	0	6,387,459	0	0	0	0
hen1-8 r2	0	2,874,203	0	0	0	0
hen1-8 heso1-1	0	6,015,054	0	0	0	0
hen1-8 mee44	0	3,435,030	0	0	0	0
Wt_d	42	7,517,450	6	11	28	56
Col_d	15	11,692,099	1	3	6	13

Link to FindMiRNA for this sequence