Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGGATTGGTCAAGGGAAGCGT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
13w6,217,559Phasing windowath-MIR3440bw6,217,4766,217,600miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1394,877,516  8164080
C0F252,789,465  24918
d1F163,574,742  23817
d1F2113,705,660  361530
d234F1551,417,116  3978194388
d234F22553,822,319  67133334667
r2F1672,195,923  3161153305
r2F22622,233,522  1172355871,173
r2FSb1835,728,276  3264160319
r2FNaSb1965,311,047  3774185369
r2FNa1281,834,656  153176153
r2FNa23436,081,068  56113282564
r2FL91,145,942  8163979
r2FD2094,928,142  4285212424
C0FCSb399,399,678  482141
C0FSb729,361,008  8153877
r2SC1613,743,342  163381163
r2SH212,165,395  10194897
r2SNa1122,082,930  6122958
r2SC3533,997,922  132766133
r2SNa2754,617,795  163281162
r2SSb483,278,680  152973146
r2SNaSb183,087,212  6122958
r2SC25476,105  112153105
r2SP26976,646  2753133266
C0RC111,249,181  1248
C0RNi11,211,490  1248
AtCM014,488,208  0000
AT_Leaf28,047,907  1112
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-118,736,008  1111
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d147,517,450  24919
Col_d011,692,099  0000


Link to FindMiRNA for this sequence