Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGGCAGGAAAGACATAATTTT
Length: 21 nucleotides
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15c7,122,586Phasing windowAT5G20960w7,116,7387,122,774aldehyde oxidase 1




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F134,877,516  1136
C0F222,789,465  1147
d1F103,574,742  0000
d1F203,705,660  0000
d234F111,417,116  1147
d234F243,822,319  12510
r2F152,195,923  251123
r2F222,233,522  1249
r2FSb35,728,276  1135
r2FNaSb15,311,047  1112
r2FNa151,834,656  351427
r2FNa216,081,068  1112
r2FL01,145,942  0000
r2FD14,928,142  1112
C0FCSb19,399,678  1111
C0FSb39,361,008  1123
r2SC103,743,342  0000
r2SH92,165,395  482142
r2SNa102,082,930  0000
r2SC343,997,922  12510
r2SNa244,617,795  1249
r2SSb23,278,680  1136
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP7976,646  7143672
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM014,488,208  0000
AT_Leaf08,047,907  0000
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d07,517,450  0000
Col_d011,692,099  0000


Link to FindMiRNA for this sequence