Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGGCTTGGTTTATGTACACCG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
12c17,349,568Phasing windowAT2G41616c17,349,43717,349,574miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
22c17,349,568Phasing windowAT2G41620c17,347,30417,355,084unknown function
32c17,349,568Phasing windowath-MIR778c17,349,43717,349,574miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F184,877,516  23816
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F141,417,116  361428
d234F223,822,319  1135
r2F182,195,923  471836
r2F292,233,522  482040
r2FSb145,728,276  251224
r2FNaSb205,311,047  481938
r2FNa1131,834,656  7143571
r2FNa2126,081,068  241020
r2FL101,145,942  9174487
r2FD234,928,142  592347
C0FCSb19,399,678  1111
C0FSb19,361,008  1111
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa204,617,795  0000
r2SSb03,278,680  0000
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP0976,646  0000
C0RC111,249,181  1248
C0RNi01,211,490  0000
AtCM1014,488,208  1137
AT_Leaf08,047,907  0000
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-116,244,400  1112
hen1-8 urt1-116,081,292  1112
hen1-8 ntp4-114,626,878  1112
hen1-8 ntp5-125,676,073  1124
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-196,015,054  13715
hen1-8 mee4413,435,030  1113
Wt_d2107,517,450  2856140279
Col_d111,692,099  1111


Link to FindMiRNA for this sequence