Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGGGTGGCAAACAAAGACGAC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
13c19,659,597Phasing windowAT3G53016c19,659,57119,659,676MIR851a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
23c19,659,597Phasing windowath-MIR851c19,659,53219,659,715miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F12014,877,516  4182206412
C0F2292,789,465  102152104
d1F11643,574,742  4692229459
d1F21063,705,660  2957143286
d234F12981,417,116  2104211,0512,103
d234F25763,822,319  1513017531,507
r2F16692,195,923  3056091,5233,047
r2F21372,233,522  61123307613
r2FSb1,0205,728,276  1783568901,781
r2FNaSb8455,311,047  1593187961,591
r2FNa13341,834,656  1823649101,821
r2FNa29356,081,068  1543087691,538
r2FL841,145,942  73147367733
r2FD4884,928,142  99198495990
C0FCSb949,399,678  102050100
C0FSb4259,361,008  4591227454
r2SC163,743,342  23816
r2SH12,165,395  1125
r2SNa102,082,930  0000
r2SC313,997,922  1113
r2SNa234,617,795  1136
r2SSb13,278,680  1123
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP0976,646  0000
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM14314,488,208  10204999
AT_Leaf08,047,907  0000
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_212,446,954  1124
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-845,456,831  1147
hen1-8 ntp2-156,244,400  1248
hen1-8 urt1-116,081,292  1112
hen1-8 ntp4-154,626,878  12511
hen1-8 ntp5-135,676,073  1135
hen1-8 ntp6-1254,328,718  6122958
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-188,736,008  1259
hen1-8 ntp10-196,387,459  13714
hen1-8 r202,874,203  0000
hen1-8 heso1-126,015,054  1123
hen1-8 mee4413,435,030  1113
Wt_d347,517,450  592345
Col_d111,692,099  1111


Link to FindMiRNA for this sequence