Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGTGCAAATGCTTTCTACAGG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15c897,087Phasing windowAT5G03552c897,020897,356MIR822a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25c897,087Phasing windowath-MIR822c897,020897,356miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F203,822,319  0000
r2F102,195,923  0000
r2F202,233,522  0000
r2FSb05,728,276  0000
r2FNaSb05,311,047  0000
r2FNa101,834,656  0000
r2FNa206,081,068  0000
r2FL01,145,942  0000
r2FD04,928,142  0000
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa204,617,795  0000
r2SSb03,278,680  0000
r2SNaSb03,087,212  0000
r2SC25476,105  112153105
r2SP1976,646  12510
C0RC11261,249,181  1012025041,009
C0RNi1161,211,490  96191479957
AtCM214,488,208  1111
AT_Leaf1338,047,907  173383165
At_miR1507OX_131,478,373  241020
At_miR1507OX_221,638,916  12612
At_miR2109OX_151,760,055  361428
At_miR2109OX_2112,446,954  492245
At_miR2118aOX_111,212,493  1248
At_miR2118aOX_231,258,140  251224
At_miR2118bOX_172,023,619  371735
At_miR2118bOX_251,733,586  361429
At_miR2118cOX_161,995,522  361530
At_miR2118cOX_232,496,180  12612
At_miROX_control81,838,508  492244
At_miROX_ck_271,804,409  481939
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-115,676,073  1112
hen1-8 ntp6-114,328,718  1112
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d27,517,450  1113
Col_d211,692,099  1112


Link to FindMiRNA for this sequence