Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGTTAAGGAGTGTTAACGGTG
Length: 21 nucleotides
Number of hits: 6

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11c20,622,582Phasing windowLink to IGR (2,824 bp)Small region at sequence (3 kb)

Other perfect matches found in genome in addition to that listed above.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
22w1,652,537Phasing windowLink to IGR (1,251 bp)Small region at sequence (3 kb)
34w1,024,077Phasing windowAT4G02320c1,022,7251,026,118Plant invertase/pectin methylesterase inhibitor superfamily
44c13,316,794Phasing windowLink to IGR (862 bp)Small region at sequence (3 kb)
55w6,926,272Phasing windowLink to IGR (736 bp)Small region at sequence (3 kb)
65w16,970,885Phasing windowLink to IGR (880 bp)Small region at sequence (3 kb)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F144,877,516  1248
C0F202,789,465  0000
d1F163,574,742  23817
d1F203,705,660  0000
d234F1131,417,116  9184692
d234F2213,822,319  5112755
r2F142,195,923  24918
r2F212,233,522  1124
r2FSb55,728,276  1249
r2FNaSb15,311,047  1112
r2FNa111,834,656  1135
r2FNa226,081,068  1123
r2FL21,145,942  23917
r2FD34,928,142  1136
C0FCSb69,399,678  1136
C0FSb59,361,008  1135
r2SC1303,743,342  8164080
r2SH212,165,395  10194897
r2SNa192,082,930  492243
r2SC373,997,922  24918
r2SNa2164,617,795  371735
r2SSb23,278,680  1136
r2SNaSb63,087,212  241019
r2SC21476,105  241121
r2SP3976,646  361531
C0RC121,249,181  23816
C0RNi61,211,490  5102550
AtCM014,488,208  0000
AT_Leaf08,047,907  0000
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d37,517,450  1124
Col_d011,692,099  0000


Link to FindMiRNA for this sequence