Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TGTTTTGTGCTTGAATCTAATT
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
12w19,415,077Phasing windowAT2G47275w19,415,05219,415,186miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
22w19,415,077Phasing windowath-MIR403w19,415,05219,415,186miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F114,877,516  1112
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F2153,822,319  482039
r2F132,195,923  13714
r2F2102,233,522  492245
r2FSb85,728,276  13714
r2FNaSb65,311,047  12611
r2FNa111,834,656  1135
r2FNa246,081,068  1137
r2FL41,145,942  371735
r2FD144,928,142  361428
C0FCSb19,399,678  1111
C0FSb19,361,008  1111
r2SC153,743,342  13713
r2SH32,165,395  13714
r2SNa102,082,930  0000
r2SC323,997,922  1135
r2SNa214,617,795  1112
r2SSb23,278,680  1136
r2SNaSb33,087,212  12510
r2SC214476,105  2959147294
r2SP17976,646  173587174
C0RC1541,249,181  4386216432
C0RNi101,211,490  8174183
AtCM514,488,208  1123
AT_Leaf1528,047,907  193894189
At_miR1507OX_1301,478,373  2041101203
At_miR1507OX_2251,638,916  153176153
At_miR2109OX_1171,760,055  10194897
At_miR2109OX_2392,446,954  163280159
At_miR2118aOX_1191,212,493  163178157
At_miR2118aOX_2291,258,140  2346115230
At_miR2118bOX_1222,023,619  112254109
At_miR2118bOX_2201,733,586  122358115
At_miR2118cOX_1421,995,522  2142105210
At_miR2118cOX_2232,496,180  9184692
At_miROX_control361,838,508  203998196
At_miROX_ck_2181,804,409  102050100
hen1-8215,456,831  481938
hen1-8 ntp2-1206,244,400  361632
hen1-8 urt1-1136,081,292  241121
hen1-8 ntp4-1194,626,878  482141
hen1-8 ntp5-1395,676,073  7143469
hen1-8 ntp6-12904,328,718  67134335670
hen1-8 ntp7-1164,409,080  471836
hen1-8 ntp8-1308,736,008  371734
hen1-8 ntp10-1316,387,459  5102449
hen1-8 r2162,874,203  6112856
hen1-8 heso1-1156,015,054  251225
hen1-8 mee44203,435,030  6122958
Wt_d137,517,450  23917
Col_d7611,692,099  7133365


Link to FindMiRNA for this sequence