Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TTCCACAGCTTTCTTGAACTT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	5	w	13,611,808	Phasing window	AT5G35407	w	13,611,798	13,611,932	MIR396B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	5	w	13,611,808	Phasing window	ath-MIR396b	w	13,611,798	13,611,932	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	32	4,877,516	7	13	33	66
C0F2	661	2,789,465	237	474	1,185	2,370
d1F1	6	3,574,742	2	3	8	17
d1F2	28	3,705,660	8	15	38	76
d234F1	16	1,417,116	11	23	56	113
d234F2	449	3,822,319	117	235	587	1,175
r2F1	45	2,195,923	20	41	102	205
r2F2	487	2,233,522	218	436	1,090	2,180
r2FSb	284	5,728,276	50	99	248	496
r2FNaSb	413	5,311,047	78	156	389	778
r2FNa1	156	1,834,656	85	170	425	850
r2FNa2	443	6,081,068	73	146	364	728
r2FL	164	1,145,942	143	286	716	1,431
r2FD	283	4,928,142	57	115	287	574
C0FCSb	1	9,399,678	1	1	1	1
C0FSb	9	9,361,008	1	2	5	10
r2SC1	37	3,743,342	10	20	49	99
r2SH	21	2,165,395	10	19	48	97
r2SNa1	11	2,082,930	5	11	26	53
r2SC3	70	3,997,922	18	35	88	175
r2SNa2	46	4,617,795	10	20	50	100
r2SSb	111	3,278,680	34	68	169	339
r2SNaSb	111	3,087,212	36	72	180	360
r2SC2	337	476,105	708	1,416	3,539	7,078
r2SP	107	976,646	110	219	548	1,096
C0RC1	922	1,249,181	738	1,476	3,690	7,381
C0RNi	129	1,211,490	106	213	532	1,065
AtCM	61	14,488,208	4	8	21	42
AT_Leaf	79,011	8,047,907	9,818	19,635	49,088	98,176
At_miR1507OX_1	1,940	1,478,373	1,312	2,625	6,561	13,123
At_miR1507OX_2	2,731	1,638,916	1,666	3,333	8,332	16,663
At_miR2109OX_1	2,063	1,760,055	1,172	2,344	5,861	11,721
At_miR2109OX_2	5,406	2,446,954	2,209	4,419	11,046	22,093
At_miR2118aOX_1	1,479	1,212,493	1,220	2,440	6,099	12,198
At_miR2118aOX_2	3,020	1,258,140	2,400	4,801	12,002	24,004
At_miR2118bOX_1	2,996	2,023,619	1,481	2,961	7,403	14,805
At_miR2118bOX_2	1,437	1,733,586	829	1,658	4,145	8,289
At_miR2118cOX_1	4,026	1,995,522	2,018	4,035	10,088	20,175
At_miR2118cOX_2	3,735	2,496,180	1,496	2,993	7,481	14,963
At_miROX_control	4,145	1,838,508	2,255	4,509	11,273	22,545
At_miROX_ck_2	3,311	1,804,409	1,835	3,670	9,175	18,349
hen1-8	8,356	5,456,831	1,531	3,063	7,656	15,313
hen1-8 ntp2-1	6,728	6,244,400	1,077	2,155	5,387	10,774
hen1-8 urt1-1	6,995	6,081,292	1,150	2,300	5,751	11,502
hen1-8 ntp4-1	8,321	4,626,878	1,798	3,597	8,992	17,984
hen1-8 ntp5-1	12,455	5,676,073	2,194	4,389	10,971	21,943
hen1-8 ntp6-1	43,940	4,328,718	10,151	20,302	50,754	101,508
hen1-8 ntp7-1	7,220	4,409,080	1,638	3,275	8,188	16,375
hen1-8 ntp8-1	15,920	8,736,008	1,822	3,645	9,112	18,223
hen1-8 ntp10-1	9,594	6,387,459	1,502	3,004	7,510	15,020
hen1-8 r2	8,214	2,874,203	2,858	5,716	14,289	28,578
hen1-8 heso1-1	11,416	6,015,054	1,898	3,796	9,490	18,979
hen1-8 mee44	9,557	3,435,030	2,782	5,564	13,911	27,822
Wt_d	275	7,517,450	37	73	183	366
Col_d	47,398	11,692,099	4,054	8,108	20,269	40,538

Link to FindMiRNA for this sequence