Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTCGAGGCCTATTAAACCTCTG
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w29,016,586Phasing windowAT1G77230w29,016,12029,019,768Tetratricopeptide repeat (TPR)-like superfamily protein

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w29,016,586Phasing windowAT1G77235w29,016,52029,016,828MIR402; miRNA
31w29,016,586Phasing windowath-MIR402w29,016,52029,016,828miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1334,877,516  7143468
C0F222,789,465  1147
d1F103,574,742  0000
d1F203,705,660  0000
d234F1341,417,116  2448120240
d234F243,822,319  12510
r2F1952,195,923  4387216433
r2F2172,233,522  8153876
r2FSb685,728,276  122459119
r2FNaSb655,311,047  122461122
r2FNa11711,834,656  93186466932
r2FNa2856,081,068  142870140
r2FL1141,145,942  99199497995
r2FD1514,928,142  3161153306
C0FCSb69,399,678  1136
C0FSb119,361,008  12612
r2SC193,743,342  251224
r2SH162,165,395  7153774
r2SNa102,082,930  0000
r2SC3153,997,922  481938
r2SNa234,617,795  1136
r2SSb113,278,680  371734
r2SNaSb143,087,212  592345
r2SC212476,105  2550126252
r2SP3976,646  361531
C0RC1311,249,181  2550124248
C0RNi191,211,490  163178157
AtCM3,10714,488,208  2144291,0722,145
AT_Leaf08,047,907  0000
At_miR1507OX_101,478,373  0000
At_miR1507OX_211,638,916  1136
At_miR2109OX_101,760,055  0000
At_miR2109OX_212,446,954  1124
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_122,023,619  12510
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_131,995,522  23815
At_miR2118cOX_212,496,180  1124
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-835,456,831  1135
hen1-8 ntp2-146,244,400  1136
hen1-8 urt1-136,081,292  1125
hen1-8 ntp4-134,626,878  1136
hen1-8 ntp5-125,676,073  1124
hen1-8 ntp6-1154,328,718  371735
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-118,736,008  1111
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-1116,015,054  24918
hen1-8 mee4443,435,030  12612
Wt_d2747,517,450  3673182364
Col_d311,692,099  1113


Link to FindMiRNA for this sequence