Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TTCTCAAGAAGGTGCATGAAC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	11,159,774	Phasing window	AT2G26211	w	11,159,702	11,159,803	MIR825a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	w	11,159,774	Phasing window	ath-MIR825	w	11,159,660	11,159,845	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	21	4,877,516	4	9	22	43
C0F2	7	2,789,465	3	5	13	25
d1F1	19	3,574,742	5	11	27	53
d1F2	1	3,705,660	1	1	1	3
d234F1	20	1,417,116	14	28	71	141
d234F2	49	3,822,319	13	26	64	128
r2F1	105	2,195,923	48	96	239	478
r2F2	60	2,233,522	27	54	134	269
r2FSb	147	5,728,276	26	51	128	257
r2FNaSb	106	5,311,047	20	40	100	200
r2FNa1	29	1,834,656	16	32	79	158
r2FNa2	53	6,081,068	9	17	44	87
r2FL	18	1,145,942	16	31	79	157
r2FD	165	4,928,142	33	67	167	335
C0FCSb	1	9,399,678	1	1	1	1
C0FSb	9	9,361,008	1	2	5	10
r2SC1	697	3,743,342	186	372	931	1,862
r2SH	1,764	2,165,395	815	1,629	4,073	8,146
r2SNa1	740	2,082,930	355	711	1,776	3,553
r2SC3	273	3,997,922	68	137	341	683
r2SNa2	150	4,617,795	32	65	162	325
r2SSb	382	3,278,680	117	233	583	1,165
r2SNaSb	199	3,087,212	64	129	322	645
r2SC2	40	476,105	84	168	420	840
r2SP	42	976,646	43	86	215	430
C0RC1	0	1,249,181	0	0	0	0
C0RNi	0	1,211,490	0	0	0	0
AtCM	3	14,488,208	1	1	1	2
AT_Leaf	55	8,047,907	7	14	34	68
At_miR1507OX_1	16	1,478,373	11	22	54	108
At_miR1507OX_2	17	1,638,916	10	21	52	104
At_miR2109OX_1	18	1,760,055	10	20	51	102
At_miR2109OX_2	34	2,446,954	14	28	69	139
At_miR2118aOX_1	17	1,212,493	14	28	70	140
At_miR2118aOX_2	30	1,258,140	24	48	119	238
At_miR2118bOX_1	28	2,023,619	14	28	69	138
At_miR2118bOX_2	21	1,733,586	12	24	61	121
At_miR2118cOX_1	25	1,995,522	13	25	63	125
At_miR2118cOX_2	33	2,496,180	13	26	66	132
At_miROX_control	30	1,838,508	16	33	82	163
At_miROX_ck_2	17	1,804,409	9	19	47	94
hen1-8	13	5,456,831	2	5	12	24
hen1-8 ntp2-1	9	6,244,400	1	3	7	14
hen1-8 urt1-1	16	6,081,292	3	5	13	26
hen1-8 ntp4-1	8	4,626,878	2	3	9	17
hen1-8 ntp5-1	16	5,676,073	3	6	14	28
hen1-8 ntp6-1	40	4,328,718	9	18	46	92
hen1-8 ntp7-1	12	4,409,080	3	5	14	27
hen1-8 ntp8-1	13	8,736,008	1	3	7	15
hen1-8 ntp10-1	5	6,387,459	1	2	4	8
hen1-8 r2	7	2,874,203	2	5	12	24
hen1-8 heso1-1	13	6,015,054	2	4	11	22
hen1-8 mee44	12	3,435,030	3	7	17	35
Wt_d	11	7,517,450	1	3	7	15
Col_d	14	11,692,099	1	2	6	12

Link to FindMiRNA for this sequence