Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TTCTTCGTGAATATCTGGCAT
Length: 21 nucleotides
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	4	c	8,504,165	Phasing window	AT4G14810	w	8,504,145	8,504,509

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	4	c	8,504,165	Phasing window	AT4G14811	c	8,504,141	8,504,314	MIR780a; miRNA
3	4	c	8,504,165	Phasing window	ath-MIR780	c	8,504,141	8,504,314	miRNA
4	4	c	8,504,165	Phasing window	AT4G14810	w	8,504,145	8,504,509
5	4	c	8,504,165	Phasing window	AT4G14811	c	8,504,141	8,504,314	MIR780a; miRNA
6	4	c	8,504,165	Phasing window	ath-MIR780	c	8,504,141	8,504,314	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	1,070	4,877,516	219	439	1,097	2,194
C0F2	2,248	2,789,465	806	1,612	4,029	8,059
d1F1	40	3,574,742	11	22	56	112
d1F2	298	3,705,660	80	161	402	804
d234F1	647	1,417,116	457	913	2,283	4,566
d234F2	11,348	3,822,319	2,969	5,938	14,844	29,689
r2F1	2,261	2,195,923	1,030	2,059	5,148	10,296
r2F2	6,897	2,233,522	3,088	6,176	15,440	30,879
r2FSb	6,895	5,728,276	1,204	2,407	6,018	12,037
r2FNaSb	9,644	5,311,047	1,816	3,632	9,079	18,158
r2FNa1	2,439	1,834,656	1,329	2,659	6,647	13,294
r2FNa2	19,091	6,081,068	3,139	6,279	15,697	31,394
r2FL	1,334	1,145,942	1,164	2,328	5,821	11,641
r2FD	10,299	4,928,142	2,090	4,180	10,449	20,898
C0FCSb	261	9,399,678	28	56	139	278
C0FSb	1,090	9,361,008	116	233	582	1,164
r2SC1	0	3,743,342	0	0	0	0
r2SH	2	2,165,395	1	2	5	9
r2SNa1	0	2,082,930	0	0	0	0
r2SC3	4	3,997,922	1	2	5	10
r2SNa2	17	4,617,795	4	7	18	37
r2SSb	3	3,278,680	1	2	5	9
r2SNaSb	3	3,087,212	1	2	5	10
r2SC2	5	476,105	11	21	53	105
r2SP	5	976,646	5	10	26	51
C0RC1	18	1,249,181	14	29	72	144
C0RNi	18	1,211,490	15	30	74	149
AtCM	3,014	14,488,208	208	416	1,040	2,080
AT_Leaf	0	8,047,907	0	0	0	0
At_miR1507OX_1	0	1,478,373	0	0	0	0
At_miR1507OX_2	0	1,638,916	0	0	0	0
At_miR2109OX_1	0	1,760,055	0	0	0	0
At_miR2109OX_2	0	2,446,954	0	0	0	0
At_miR2118aOX_1	0	1,212,493	0	0	0	0
At_miR2118aOX_2	0	1,258,140	0	0	0	0
At_miR2118bOX_1	0	2,023,619	0	0	0	0
At_miR2118bOX_2	1	1,733,586	1	1	3	6
At_miR2118cOX_1	0	1,995,522	0	0	0	0
At_miR2118cOX_2	0	2,496,180	0	0	0	0
At_miROX_control	0	1,838,508	0	0	0	0
At_miROX_ck_2	0	1,804,409	0	0	0	0
hen1-8	504	5,456,831	92	185	462	924
hen1-8 ntp2-1	664	6,244,400	106	213	532	1,063
hen1-8 urt1-1	913	6,081,292	150	300	751	1,501
hen1-8 ntp4-1	589	4,626,878	127	255	636	1,273
hen1-8 ntp5-1	816	5,676,073	144	288	719	1,438
hen1-8 ntp6-1	2,105	4,328,718	486	973	2,431	4,863
hen1-8 ntp7-1	423	4,409,080	96	192	480	959
hen1-8 ntp8-1	1,055	8,736,008	121	242	604	1,208
hen1-8 ntp10-1	791	6,387,459	124	248	619	1,238
hen1-8 r2	181	2,874,203	63	126	315	630
hen1-8 heso1-1	1,989	6,015,054	331	661	1,653	3,307
hen1-8 mee44	181	3,435,030	53	105	263	527
Wt_d	7,126	7,517,450	948	1,896	4,740	9,479
Col_d	6,031	11,692,099	516	1,032	2,579	5,158

Link to FindMiRNA for this sequence