Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TTGAAGAGGACTTGGAACTTCGAT
Length: 24 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	1	w	24,884,359	Phasing window	AT1G66725	w	24,883,931	24,884,559	MIR163; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	1	w	24,884,359	Phasing window	ath-MIR163	w	24,884,066	24,884,396	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	293	4,877,516	60	120	300	601
C0F2	71	2,789,465	25	51	127	255
d1F1	2	3,574,742	1	1	3	6
d1F2	2	3,705,660	1	1	3	5
d234F1	144	1,417,116	102	203	508	1,016
d234F2	400	3,822,319	105	209	523	1,046
r2F1	778	2,195,923	354	709	1,771	3,543
r2F2	2,452	2,233,522	1,098	2,196	5,489	10,978
r2FSb	1,501	5,728,276	262	524	1,310	2,620
r2FNaSb	1,343	5,311,047	253	506	1,264	2,529
r2FNa1	1,039	1,834,656	566	1,133	2,832	5,663
r2FNa2	904	6,081,068	149	297	743	1,487
r2FL	1,171	1,145,942	1,022	2,044	5,109	10,219
r2FD	1,597	4,928,142	324	648	1,620	3,241
C0FCSb	540	9,399,678	57	115	287	574
C0FSb	340	9,361,008	36	73	182	363
r2SC1	76	3,743,342	20	41	102	203
r2SH	75	2,165,395	35	69	173	346
r2SNa1	148	2,082,930	71	142	355	711
r2SC3	325	3,997,922	81	163	406	813
r2SNa2	296	4,617,795	64	128	320	641
r2SSb	93	3,278,680	28	57	142	284
r2SNaSb	279	3,087,212	90	181	452	904
r2SC2	59	476,105	124	248	620	1,239
r2SP	119	976,646	122	244	609	1,218
C0RC1	49	1,249,181	39	78	196	392
C0RNi	57	1,211,490	47	94	235	470
AtCM	1,485	14,488,208	102	205	512	1,025
AT_Leaf	4,112	8,047,907	511	1,022	2,555	5,109
At_miR1507OX_1	3,651	1,478,373	2,470	4,939	12,348	24,696
At_miR1507OX_2	3,010	1,638,916	1,837	3,673	9,183	18,366
At_miR2109OX_1	3,040	1,760,055	1,727	3,454	8,636	17,272
At_miR2109OX_2	9,064	2,446,954	3,704	7,408	18,521	37,042
At_miR2118aOX_1	2,609	1,212,493	2,152	4,304	10,759	21,518
At_miR2118aOX_2	2,653	1,258,140	2,109	4,217	10,543	21,087
At_miR2118bOX_1	5,340	2,023,619	2,639	5,278	13,194	26,388
At_miR2118bOX_2	4,025	1,733,586	2,322	4,644	11,609	23,218
At_miR2118cOX_1	6,825	1,995,522	3,420	6,840	17,101	34,202
At_miR2118cOX_2	7,737	2,496,180	3,100	6,199	15,498	30,995
At_miROX_control	6,852	1,838,508	3,727	7,454	18,635	37,269
At_miROX_ck_2	3,586	1,804,409	1,987	3,975	9,937	19,874
hen1-8	536	5,456,831	98	196	491	982
hen1-8 ntp2-1	716	6,244,400	115	229	573	1,147
hen1-8 urt1-1	2,018	6,081,292	332	664	1,659	3,318
hen1-8 ntp4-1	642	4,626,878	139	278	694	1,388
hen1-8 ntp5-1	1,334	5,676,073	235	470	1,175	2,350
hen1-8 ntp6-1	6,693	4,328,718	1,546	3,092	7,731	15,462
hen1-8 ntp7-1	486	4,409,080	110	220	551	1,102
hen1-8 ntp8-1	1,199	8,736,008	137	274	686	1,372
hen1-8 ntp10-1	686	6,387,459	107	215	537	1,074
hen1-8 r2	511	2,874,203	178	356	889	1,778
hen1-8 heso1-1	910	6,015,054	151	303	756	1,513
hen1-8 mee44	434	3,435,030	126	253	632	1,263
Wt_d	278	7,517,450	37	74	185	370
Col_d	6,374	11,692,099	545	1,090	2,726	5,452

Link to FindMiRNA for this sequence