Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTGAATGTGAATGAATCGGGC
Length: 21 nucleotides
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11c23,413,422Phasing windowAT1G63130w23,412,73023,415,149Tetratricopeptide repeat (TPR)-like superfamily protein




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F154,877,516  12510
C0F212,789,465  1124
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F203,822,319  0000
r2F1162,195,923  7153673
r2F2332,233,522  153074148
r2FSb405,728,276  7143570
r2FNaSb525,311,047  10204998
r2FNa121,834,656  12511
r2FNa2816,081,068  132767133
r2FL31,145,942  351326
r2FD394,928,142  8164079
C0FCSb19,399,678  1111
C0FSb69,361,008  1136
r2SC1233,743,342  6123161
r2SH182,165,395  8174283
r2SNa162,082,930  361429
r2SC3353,997,922  9184488
r2SNa2214,617,795  592345
r2SSb293,278,680  9184488
r2SNaSb163,087,212  5102652
r2SC25476,105  112153105
r2SP10976,646  102051102
C0RC101,249,181  0000
C0RNi31,211,490  251225
AtCM014,488,208  0000
AT_Leaf518,047,907  6133263
At_miR1507OX_111,478,373  1137
At_miR1507OX_231,638,916  24918
At_miR2109OX_101,760,055  0000
At_miR2109OX_222,446,954  1248
At_miR2118aOX_111,212,493  1248
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_132,023,619  13715
At_miR2118bOX_221,733,586  12612
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_222,496,180  1248
At_miROX_control31,838,508  23816
At_miROX_ck_221,804,409  12611
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-164,328,718  13714
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d117,517,450  13715
Col_d311,692,099  1113


Link to FindMiRNA for this sequence