Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTGAATTGAAGTGCTTGAATT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w22,577,662Phasing windowAT1G61226w22,577,41722,577,691MIR846a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w22,577,662Phasing windowath-MIR846w22,577,37522,577,733miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F213,705,660  1113
d234F121,417,116  13714
d234F2113,822,319  361429
r2F112,195,923  1125
r2F2412,233,522  183792184
r2FSb95,728,276  23816
r2FNaSb225,311,047  482141
r2FNa131,834,656  23816
r2FNa2156,081,068  251225
r2FL71,145,942  6123161
r2FD164,928,142  361632
C0FCSb19,399,678  1111
C0FSb39,361,008  1123
r2SC153,743,342  13713
r2SH62,165,395  361428
r2SNa1152,082,930  7143672
r2SC3153,997,922  481938
r2SNa2164,617,795  371735
r2SSb93,278,680  351427
r2SNaSb203,087,212  6133265
r2SC245476,105  95189473945
r2SP871976,646  8921,7844,4598,918
C0RC1151,249,181  122460120
C0RNi1981,211,490  1633278171,634
AtCM1014,488,208  1137
AT_Leaf1,3298,047,907  1653308261,651
At_miR1507OX_11681,478,373  1142275681,136
At_miR1507OX_22211,638,916  1352706741,348
At_miR2109OX_11431,760,055  81162406812
At_miR2109OX_23582,446,954  1462937321,463
At_miR2118aOX_1901,212,493  74148371742
At_miR2118aOX_21741,258,140  1382776911,383
At_miR2118bOX_12602,023,619  1282576421,285
At_miR2118bOX_21031,733,586  59119297594
At_miR2118cOX_13671,995,522  1843689201,839
At_miR2118cOX_22942,496,180  1182365891,178
At_miROX_control2791,838,508  1523047591,518
At_miROX_ck_21751,804,409  97194485970
hen1-835,456,831  1135
hen1-8 ntp2-136,244,400  1125
hen1-8 urt1-1156,081,292  251225
hen1-8 ntp4-124,626,878  1124
hen1-8 ntp5-165,676,073  12511
hen1-8 ntp6-1374,328,718  9174385
hen1-8 ntp7-124,409,080  1125
hen1-8 ntp8-198,736,008  12510
hen1-8 ntp10-166,387,459  1259
hen1-8 r212,874,203  1123
hen1-8 heso1-1136,015,054  241122
hen1-8 mee4413,435,030  1113
Wt_d87,517,450  12511
Col_d17111,692,099  152973146


Link to FindMiRNA for this sequence