Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTGAGAGCAACAAGACATAAT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
14w7,846,835Phasing windowAT4G13494w7,846,5977,846,899MIR863a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
24w7,846,835Phasing windowath-MIR863w7,846,5977,846,899miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F144,877,516  1248
C0F232,789,465  12511
d1F113,574,742  1113
d1F213,705,660  1113
d234F1121,417,116  8174285
d234F2173,822,319  492244
r2F1182,195,923  8164182
r2F272,233,522  361631
r2FSb175,728,276  361530
r2FNaSb95,311,047  23817
r2FNa191,834,656  5102549
r2FNa246,081,068  1137
r2FL81,145,942  7143570
r2FD134,928,142  351326
C0FCSb19,399,678  1111
C0FSb29,361,008  1112
r2SC13033,743,342  81162405809
r2SH1732,165,395  80160399799
r2SNa11412,082,930  68135338677
r2SC3793,997,922  204099198
r2SNa2374,617,795  8164080
r2SSb493,278,680  153075149
r2SNaSb803,087,212  2652130259
r2SC26476,105  132563126
r2SP30976,646  3161154307
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM114,488,208  1111
AT_Leaf288,047,907  371735
At_miR1507OX_1131,478,373  9184488
At_miR1507OX_2171,638,916  102152104
At_miR2109OX_1181,760,055  102051102
At_miR2109OX_2162,446,954  7133365
At_miR2118aOX_161,212,493  5102549
At_miR2118aOX_2151,258,140  122460119
At_miR2118bOX_1202,023,619  10204999
At_miR2118bOX_2101,733,586  6122958
At_miR2118cOX_1131,995,522  7133365
At_miR2118cOX_2222,496,180  9184488
At_miROX_control121,838,508  7133365
At_miROX_ck_2201,804,409  112255111
hen1-815,456,831  1112
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-126,081,292  1123
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-144,328,718  1259
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-118,736,008  1111
hen1-8 ntp10-116,387,459  1112
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d47,517,450  1135
Col_d411,692,099  1123


Link to FindMiRNA for this sequence