Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TTGAGCCGTGCCAATATCACG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	1	c	3,961,387	Phasing window	AT1G11735	c	3,961,348	3,961,464	MIR171B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	1	c	3,961,387	Phasing window	ath-MIR171b	c	3,961,348	3,961,464	miRNA
3	1	c	22,930,115	Phasing window	AT1G62035	c	22,930,089	22,930,204	MIR171C; miRNA
4	1	c	22,930,115	Phasing window	ath-MIR171c	c	22,930,089	22,930,204	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	11	4,877,516	2	5	11	23
C0F2	3	2,789,465	1	2	5	11
d1F1	6	3,574,742	2	3	8	17
d1F2	5	3,705,660	1	3	7	13
d234F1	8	1,417,116	6	11	28	56
d234F2	39	3,822,319	10	20	51	102
r2F1	42	2,195,923	19	38	96	191
r2F2	18	2,233,522	8	16	40	81
r2FSb	259	5,728,276	45	90	226	452
r2FNaSb	336	5,311,047	63	127	316	633
r2FNa1	82	1,834,656	45	89	223	447
r2FNa2	259	6,081,068	43	85	213	426
r2FL	36	1,145,942	31	63	157	314
r2FD	303	4,928,142	61	123	307	615
C0FCSb	2	9,399,678	1	1	1	2
C0FSb	3	9,361,008	1	1	2	3
r2SC1	7	3,743,342	2	4	9	19
r2SH	10	2,165,395	5	9	23	46
r2SNa1	0	2,082,930	0	0	0	0
r2SC3	40	3,997,922	10	20	50	100
r2SNa2	18	4,617,795	4	8	19	39
r2SSb	17	3,278,680	5	10	26	52
r2SNaSb	92	3,087,212	30	60	149	298
r2SC2	2	476,105	4	8	21	42
r2SP	1	976,646	1	2	5	10
C0RC1	17	1,249,181	14	27	68	136
C0RNi	28	1,211,490	23	46	116	231
AtCM	549	14,488,208	38	76	189	379
AT_Leaf	884	8,047,907	110	220	549	1,098
At_miR1507OX_1	8	1,478,373	5	11	27	54
At_miR1507OX_2	18	1,638,916	11	22	55	110
At_miR2109OX_1	15	1,760,055	9	17	43	85
At_miR2109OX_2	31	2,446,954	13	25	63	127
At_miR2118aOX_1	14	1,212,493	12	23	58	115
At_miR2118aOX_2	24	1,258,140	19	38	95	191
At_miR2118bOX_1	21	2,023,619	10	21	52	104
At_miR2118bOX_2	15	1,733,586	9	17	43	87
At_miR2118cOX_1	23	1,995,522	12	23	58	115
At_miR2118cOX_2	28	2,496,180	11	22	56	112
At_miROX_control	22	1,838,508	12	24	60	120
At_miROX_ck_2	34	1,804,409	19	38	94	188
hen1-8	52	5,456,831	10	19	48	95
hen1-8 ntp2-1	51	6,244,400	8	16	41	82
hen1-8 urt1-1	71	6,081,292	12	23	58	117
hen1-8 ntp4-1	54	4,626,878	12	23	58	117
hen1-8 ntp5-1	117	5,676,073	21	41	103	206
hen1-8 ntp6-1	444	4,328,718	103	205	513	1,026
hen1-8 ntp7-1	47	4,409,080	11	21	53	107
hen1-8 ntp8-1	112	8,736,008	13	26	64	128
hen1-8 ntp10-1	62	6,387,459	10	19	49	97
hen1-8 r2	66	2,874,203	23	46	115	230
hen1-8 heso1-1	160	6,015,054	27	53	133	266
hen1-8 mee44	53	3,435,030	15	31	77	154
Wt_d	322	7,517,450	43	86	214	428
Col_d	246	11,692,099	21	42	105	210

Link to FindMiRNA for this sequence