Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TTGGACTGAAGGGAGCTCCCT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	4	w	12,353,109	Phasing window	AT4G23713	w	12,352,956	12,353,131	MIR319/MIR319a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	4	w	12,353,109	Phasing window	ath-MIR319a	w	12,352,956	12,353,131	miRNA
3	5	c	16,660,489	Phasing window	AT5G41663	c	16,660,469	16,660,640	MIR319/MIR319B; miRNA
4	5	c	16,660,489	Phasing window	ath-MIR319b	c	16,660,469	16,660,640	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	108	4,877,516	22	44	111	221
C0F2	30	2,789,465	11	22	54	108
d1F1	10	3,574,742	3	6	14	28
d1F2	1	3,705,660	1	1	1	3
d234F1	66	1,417,116	47	93	233	466
d234F2	163	3,822,319	43	85	213	426
r2F1	258	2,195,923	117	235	587	1,175
r2F2	93	2,233,522	42	83	208	416
r2FSb	673	5,728,276	117	235	587	1,175
r2FNaSb	777	5,311,047	146	293	731	1,463
r2FNa1	399	1,834,656	217	435	1,087	2,175
r2FNa2	839	6,081,068	138	276	690	1,380
r2FL	168	1,145,942	147	293	733	1,466
r2FD	1,230	4,928,142	250	499	1,248	2,496
C0FCSb	2	9,399,678	1	1	1	2
C0FSb	8	9,361,008	1	2	4	9
r2SC1	6	3,743,342	2	3	8	16
r2SH	5	2,165,395	2	5	12	23
r2SNa1	0	2,082,930	0	0	0	0
r2SC3	39	3,997,922	10	20	49	98
r2SNa2	26	4,617,795	6	11	28	56
r2SSb	8	3,278,680	2	5	12	24
r2SNaSb	33	3,087,212	11	21	53	107
r2SC2	4	476,105	8	17	42	84
r2SP	3	976,646	3	6	15	31
C0RC1	2	1,249,181	2	3	8	16
C0RNi	11	1,211,490	9	18	45	91
AtCM	395	14,488,208	27	55	136	273
AT_Leaf	2,082	8,047,907	259	517	1,294	2,587
At_miR1507OX_1	150	1,478,373	101	203	507	1,015
At_miR1507OX_2	475	1,638,916	290	580	1,449	2,898
At_miR2109OX_1	215	1,760,055	122	244	611	1,222
At_miR2109OX_2	396	2,446,954	162	324	809	1,618
At_miR2118aOX_1	117	1,212,493	96	193	482	965
At_miR2118aOX_2	229	1,258,140	182	364	910	1,820
At_miR2118bOX_1	456	2,023,619	225	451	1,127	2,253
At_miR2118bOX_2	187	1,733,586	108	216	539	1,079
At_miR2118cOX_1	372	1,995,522	186	373	932	1,864
At_miR2118cOX_2	210	2,496,180	84	168	421	841
At_miROX_control	225	1,838,508	122	245	612	1,224
At_miROX_ck_2	330	1,804,409	183	366	914	1,829
hen1-8	20,297	5,456,831	3,720	7,439	18,598	37,196
hen1-8 ntp2-1	30,043	6,244,400	4,811	9,622	24,056	48,112
hen1-8 urt1-1	20,493	6,081,292	3,370	6,740	16,849	33,698
hen1-8 ntp4-1	14,402	4,626,878	3,113	6,225	15,563	31,127
hen1-8 ntp5-1	24,253	5,676,073	4,273	8,546	21,364	42,728
hen1-8 ntp6-1	77,937	4,328,718	18,005	36,009	90,023	180,046
hen1-8 ntp7-1	12,878	4,409,080	2,921	5,842	14,604	29,208
hen1-8 ntp8-1	30,177	8,736,008	3,454	6,909	17,272	34,543
hen1-8 ntp10-1	18,462	6,387,459	2,890	5,781	14,452	28,904
hen1-8 r2	7,994	2,874,203	2,781	5,563	13,906	27,813
hen1-8 heso1-1	18,560	6,015,054	3,086	6,171	15,428	30,856
hen1-8 mee44	9,880	3,435,030	2,876	5,752	14,381	28,762
Wt_d	120	7,517,450	16	32	80	160
Col_d	31,084	11,692,099	2,659	5,317	13,293	26,585

Link to FindMiRNA for this sequence