Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TTGGCATTCTGTCCACCTCC
Length: 20 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	1	w	7,058,207	Phasing window	AT1G20375	w	7,058,194	7,058,310	MIR394A; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	1	w	7,058,207	Phasing window	ath-MIR394a	w	7,058,194	7,058,310	miRNA
3	1	w	28,568,821	Phasing window	AT1G76135	w	28,568,808	28,568,928	MIR394B; miRNA
4	1	w	28,568,821	Phasing window	ath-MIR394b	w	28,568,808	28,568,928	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	116	4,877,516	24	48	119	238
C0F2	44	2,789,465	16	32	79	158
d1F1	28	3,574,742	8	16	39	78
d1F2	23	3,705,660	6	12	31	62
d234F1	115	1,417,116	81	162	406	812
d234F2	254	3,822,319	66	133	332	665
r2F1	264	2,195,923	120	240	601	1,202
r2F2	670	2,233,522	300	600	1,500	3,000
r2FSb	736	5,728,276	128	257	642	1,285
r2FNaSb	1,321	5,311,047	249	497	1,244	2,487
r2FNa1	863	1,834,656	470	941	2,352	4,704
r2FNa2	1,219	6,081,068	200	401	1,002	2,005
r2FL	320	1,145,942	279	558	1,396	2,792
r2FD	791	4,928,142	161	321	803	1,605
C0FCSb	0	9,399,678	0	0	0	0
C0FSb	10	9,361,008	1	2	5	11
r2SC1	10	3,743,342	3	5	13	27
r2SH	27	2,165,395	12	25	62	125
r2SNa1	1	2,082,930	1	1	2	5
r2SC3	85	3,997,922	21	43	106	213
r2SNa2	31	4,617,795	7	13	34	67
r2SSb	65	3,278,680	20	40	99	198
r2SNaSb	125	3,087,212	40	81	202	405
r2SC2	43	476,105	90	181	452	903
r2SP	3	976,646	3	6	15	31
C0RC1	17	1,249,181	14	27	68	136
C0RNi	33	1,211,490	27	54	136	272
AtCM	193,005	14,488,208	13,322	26,643	66,608	133,215
AT_Leaf	52	8,047,907	6	13	32	65
At_miR1507OX_1	66	1,478,373	45	89	223	446
At_miR1507OX_2	155	1,638,916	95	189	473	946
At_miR2109OX_1	58	1,760,055	33	66	165	330
At_miR2109OX_2	148	2,446,954	60	121	302	605
At_miR2118aOX_1	55	1,212,493	45	91	227	454
At_miR2118aOX_2	88	1,258,140	70	140	350	699
At_miR2118bOX_1	174	2,023,619	86	172	430	860
At_miR2118bOX_2	103	1,733,586	59	119	297	594
At_miR2118cOX_1	98	1,995,522	49	98	246	491
At_miR2118cOX_2	135	2,496,180	54	108	270	541
At_miROX_control	111	1,838,508	60	121	302	604
At_miROX_ck_2	134	1,804,409	74	149	371	743
hen1-8	972	5,456,831	178	356	891	1,781
hen1-8 ntp2-1	1,140	6,244,400	183	365	913	1,826
hen1-8 urt1-1	864	6,081,292	142	284	710	1,421
hen1-8 ntp4-1	761	4,626,878	164	329	822	1,645
hen1-8 ntp5-1	1,303	5,676,073	230	459	1,148	2,296
hen1-8 ntp6-1	4,368	4,328,718	1,009	2,018	5,045	10,091
hen1-8 ntp7-1	768	4,409,080	174	348	871	1,742
hen1-8 ntp8-1	1,387	8,736,008	159	318	794	1,588
hen1-8 ntp10-1	951	6,387,459	149	298	744	1,489
hen1-8 r2	381	2,874,203	133	265	663	1,326
hen1-8 heso1-1	999	6,015,054	166	332	830	1,661
hen1-8 mee44	384	3,435,030	112	224	559	1,118
Wt_d	2,621	7,517,450	349	697	1,743	3,487
Col_d	1,623	11,692,099	139	278	694	1,388

Link to FindMiRNA for this sequence