Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TTGGGGACGAGATGTTTTGTTG
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	4	c	1,528,211	Phasing window	AT4G03445	c	1,528,134	1,528,370	MIR447A; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	4	c	1,528,211	Phasing window	ath-MIR447a	c	1,528,134	1,528,370	miRNA
3	4	c	1,535,503	Phasing window	AT4G03455	c	1,535,426	1,535,661	MIR447B; miRNA
4	4	c	1,535,503	Phasing window	ath-MIR447b	c	1,535,426	1,535,661	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	166	4,877,516	34	68	170	340
C0F2	42	2,789,465	15	30	75	151
d1F1	2	3,574,742	1	1	3	6
d1F2	3	3,705,660	1	2	4	8
d234F1	118	1,417,116	83	167	416	833
d234F2	453	3,822,319	119	237	593	1,185
r2F1	240	2,195,923	109	219	546	1,093
r2F2	233	2,233,522	104	209	522	1,043
r2FSb	851	5,728,276	149	297	743	1,486
r2FNaSb	1,102	5,311,047	207	415	1,037	2,075
r2FNa1	298	1,834,656	162	325	812	1,624
r2FNa2	1,170	6,081,068	192	385	962	1,924
r2FL	177	1,145,942	154	309	772	1,545
r2FD	787	4,928,142	160	319	798	1,597
C0FCSb	106	9,399,678	11	23	56	113
C0FSb	120	9,361,008	13	26	64	128
r2SC1	43	3,743,342	11	23	57	115
r2SH	12	2,165,395	6	11	28	55
r2SNa1	11	2,082,930	5	11	26	53
r2SC3	106	3,997,922	27	53	133	265
r2SNa2	79	4,617,795	17	34	86	171
r2SSb	80	3,278,680	24	49	122	244
r2SNaSb	47	3,087,212	15	30	76	152
r2SC2	42	476,105	88	176	441	882
r2SP	139	976,646	142	285	712	1,423
C0RC1	26	1,249,181	21	42	104	208
C0RNi	58	1,211,490	48	96	239	479
AtCM	84	14,488,208	6	12	29	58
AT_Leaf	335	8,047,907	42	83	208	416
At_miR1507OX_1	0	1,478,373	0	0	0	0
At_miR1507OX_2	1	1,638,916	1	1	3	6
At_miR2109OX_1	1	1,760,055	1	1	3	6
At_miR2109OX_2	6	2,446,954	2	5	12	25
At_miR2118aOX_1	0	1,212,493	0	0	0	0
At_miR2118aOX_2	0	1,258,140	0	0	0	0
At_miR2118bOX_1	6	2,023,619	3	6	15	30
At_miR2118bOX_2	4	1,733,586	2	5	12	23
At_miR2118cOX_1	3	1,995,522	2	3	8	15
At_miR2118cOX_2	2	2,496,180	1	2	4	8
At_miROX_control	5	1,838,508	3	5	14	27
At_miROX_ck_2	8	1,804,409	4	9	22	44
hen1-8	17	5,456,831	3	6	16	31
hen1-8 ntp2-1	17	6,244,400	3	5	14	27
hen1-8 urt1-1	11	6,081,292	2	4	9	18
hen1-8 ntp4-1	10	4,626,878	2	4	11	22
hen1-8 ntp5-1	37	5,676,073	7	13	33	65
hen1-8 ntp6-1	112	4,328,718	26	52	129	259
hen1-8 ntp7-1	13	4,409,080	3	6	15	29
hen1-8 ntp8-1	19	8,736,008	2	4	11	22
hen1-8 ntp10-1	10	6,387,459	2	3	8	16
hen1-8 r2	4	2,874,203	1	3	7	14
hen1-8 heso1-1	11	6,015,054	2	4	9	18
hen1-8 mee44	12	3,435,030	3	7	17	35
Wt_d	701	7,517,450	93	186	466	932
Col_d	78	11,692,099	7	13	33	67

Link to FindMiRNA for this sequence