Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTGGTTACCCATATGGCCATC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w22,150,005Phasing windowAT1G60073w22,149,93622,150,033MIR774a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w22,150,005Phasing windowath-MIR774w22,149,93622,150,033miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F124,877,516  1124
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F131,417,116  241121
d234F213,822,319  1113
r2F162,195,923  351427
r2F212,233,522  1124
r2FSb185,728,276  361631
r2FNaSb365,311,047  7143468
r2FNa1261,834,656  142871142
r2FNa2206,081,068  371633
r2FL101,145,942  9174487
r2FD284,928,142  6112857
C0FCSb29,399,678  1112
C0FSb29,361,008  1112
r2SC103,743,342  0000
r2SH12,165,395  1125
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa204,617,795  0000
r2SSb03,278,680  0000
r2SNaSb13,087,212  1123
r2SC20476,105  0000
r2SP0976,646  0000
C0RC151,249,181  482040
C0RNi01,211,490  0000
AtCM9914,488,208  7143468
AT_Leaf08,047,907  0000
At_miR1507OX_111,478,373  1137
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_211,258,140  1248
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-815,456,831  1112
hen1-8 ntp2-116,244,400  1112
hen1-8 urt1-146,081,292  1137
hen1-8 ntp4-114,626,878  1112
hen1-8 ntp5-135,676,073  1135
hen1-8 ntp6-154,328,718  12612
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-128,736,008  1112
hen1-8 ntp10-126,387,459  1123
hen1-8 r212,874,203  1123
hen1-8 heso1-146,015,054  1137
hen1-8 mee4403,435,030  0000
Wt_d627,517,450  8164182
Col_d811,692,099  1137


Link to FindMiRNA for this sequence