Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTGTACAAATTTAAGTGTACG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w24,554,011Phasing windowAT1G65960w24,552,00324,557,730glutamate decarboxylase 2

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w24,554,011Phasing windowath-MIR5014w24,553,90924,554,049miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F174,877,516  13714
C0F262,789,465  241122
d1F1133,574,742  471836
d1F233,705,660  1248
d234F1391,417,116  2855138275
d234F2183,822,319  592447
r2F1512,195,923  2346116232
r2F2582,233,522  2652130260
r2FSb575,728,276  102050100
r2FNaSb475,311,047  9184488
r2FNa11731,834,656  94189471943
r2FNa2636,081,068  102152104
r2FL2271,145,942  1983969901,981
r2FD1584,928,142  3264160321
C0FCSb09,399,678  0000
C0FSb89,361,008  1249
r2SC123,743,342  1135
r2SH302,165,395  142869139
r2SNa102,082,930  0000
r2SC373,997,922  24918
r2SNa224,617,795  1124
r2SSb13,278,680  1123
r2SNaSb73,087,212  251123
r2SC211476,105  2346116231
r2SP0976,646  0000
C0RC1391,249,181  3162156312
C0RNi451,211,490  3774186371
AtCM44814,488,208  3162155309
AT_Leaf08,047,907  0000
At_miR1507OX_111,478,373  1137
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_212,446,954  1124
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_112,023,619  1125
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-845,456,831  1147
hen1-8 ntp2-156,244,400  1248
hen1-8 urt1-156,081,292  1248
hen1-8 ntp4-134,626,878  1136
hen1-8 ntp5-145,676,073  1147
hen1-8 ntp6-1164,328,718  471837
hen1-8 ntp7-134,409,080  1137
hen1-8 ntp8-148,736,008  1125
hen1-8 ntp10-146,387,459  1136
hen1-8 r232,874,203  12510
hen1-8 heso1-146,015,054  1137
hen1-8 mee4413,435,030  1113
Wt_d5817,517,450  77155386773
Col_d111,692,099  1111


Link to FindMiRNA for this sequence