Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTTCGTTGTCTGTTCGACCTT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11c26,773,715Phasing windowAT1G71002c26,773,53926,773,725MIR858a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21c26,773,715Phasing windowath-MIR858c26,773,53926,773,725miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F184,877,516  23816
C0F2142,789,465  5102550
d1F1163,574,742  492245
d1F213,705,660  1113
d234F1361,417,116  2551127254
d234F2193,822,319  5102550
r2F1192,195,923  9174387
r2F2262,233,522  122358116
r2FSb305,728,276  5102652
r2FNaSb235,311,047  492243
r2FNa1471,834,656  2651128256
r2FNa2296,081,068  5102448
r2FL361,145,942  3163157314
r2FD364,928,142  7153773
C0FCSb09,399,678  0000
C0FSb19,361,008  1111
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC323,997,922  1135
r2SNa214,617,795  1112
r2SSb13,278,680  1123
r2SNaSb13,087,212  1123
r2SC20476,105  0000
r2SP1976,646  12510
C0RC151,249,181  482040
C0RNi01,211,490  0000
AtCM3114,488,208  241121
AT_Leaf98,047,907  12611
At_miR1507OX_121,478,373  13714
At_miR1507OX_231,638,916  24918
At_miR2109OX_101,760,055  0000
At_miR2109OX_242,446,954  23816
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_142,023,619  241020
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_141,995,522  241020
At_miR2118cOX_252,496,180  241020
At_miROX_control11,838,508  1135
At_miROX_ck_291,804,409  5102550
hen1-81,2385,456,831  2274541,1342,269
hen1-8 ntp2-11,1656,244,400  1873739331,866
hen1-8 urt1-11,5596,081,292  2565131,2822,564
hen1-8 ntp4-11,2534,626,878  2715421,3542,708
hen1-8 ntp5-11,7865,676,073  3156291,5733,147
hen1-8 ntp6-15,1674,328,718  1,1942,3875,96811,937
hen1-8 ntp7-11,1784,409,080  2675341,3362,672
hen1-8 ntp8-12,8318,736,008  3246481,6203,241
hen1-8 ntp10-11,7266,387,459  2705401,3512,702
hen1-8 r26222,874,203  2164331,0822,164
hen1-8 heso1-11,2076,015,054  2014011,0032,007
hen1-8 mee444813,435,030  1402807001,400
Wt_d167,517,450  241121
Col_d63311,692,099  54108271541


Link to FindMiRNA for this sequence