Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTTGACGTGCTCGATCTGCTC
Length: 21 nucleotides
Number of hits: 2

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
14w2,178,984Phasing windowLink to IGR (2,985 bp)Small region at sequence (3 kb)

Other perfect matches found in genome in addition to that listed above.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
24c7,890,715Phasing windowath-MIR3932bc7,890,5707,890,719miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F203,822,319  0000
r2F112,195,923  1125
r2F202,233,522  0000
r2FSb05,728,276  0000
r2FNaSb05,311,047  0000
r2FNa111,834,656  1135
r2FNa206,081,068  0000
r2FL01,145,942  0000
r2FD14,928,142  1112
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC173,743,342  24919
r2SH02,165,395  0000
r2SNa122,082,930  12510
r2SC3153,997,922  481938
r2SNa234,617,795  1136
r2SSb83,278,680  251224
r2SNaSb103,087,212  361632
r2SC213476,105  2755137273
r2SP7976,646  7143672
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM1314,488,208  1249
AT_Leaf2478,047,907  3161153307
At_miR1507OX_191,478,373  6123061
At_miR1507OX_2171,638,916  102152104
At_miR2109OX_1101,760,055  6112857
At_miR2109OX_2222,446,954  9184590
At_miR2118aOX_151,212,493  482141
At_miR2118aOX_251,258,140  482040
At_miR2118bOX_1222,023,619  112254109
At_miR2118bOX_271,733,586  482040
At_miR2118cOX_181,995,522  482040
At_miR2118cOX_2192,496,180  8153876
At_miROX_control81,838,508  492244
At_miROX_ck_2141,804,409  8163978
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d07,517,450  0000
Col_d011,692,099  0000


Link to FindMiRNA for this sequence