Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTTGGAAATATTTGGCTTGACT
Length: 22 nucleotides
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w11,499,534Phasing windowLink to IGR (12,387 bp)Small region at sequence (3 kb)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F213,822,319  1113
r2F122,195,923  1259
r2F202,233,522  0000
r2FSb15,728,276  1112
r2FNaSb25,311,047  1124
r2FNa111,834,656  1135
r2FNa216,081,068  1112
r2FL01,145,942  0000
r2FD24,928,142  1124
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC313,997,922  1113
r2SNa214,617,795  1112
r2SSb23,278,680  1136
r2SNaSb33,087,212  12510
r2SC20476,105  0000
r2SP0976,646  0000
C0RC101,249,181  0000
C0RNi11,211,490  1248
AtCM014,488,208  0000
AT_Leaf08,047,907  0000
At_miR1507OX_121,478,373  13714
At_miR1507OX_241,638,916  251224
At_miR2109OX_121,760,055  12611
At_miR2109OX_212,446,954  1124
At_miR2118aOX_111,212,493  1248
At_miR2118aOX_231,258,140  251224
At_miR2118bOX_122,023,619  12510
At_miR2118bOX_241,733,586  251223
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_242,496,180  23816
At_miROX_control11,838,508  1135
At_miROX_ck_211,804,409  1136
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d27,517,450  1113
Col_d111,692,099  1111


Link to FindMiRNA for this sequence