Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TTTGGATTGAAGGGAGCTCTT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	1	w	6,220,813	Phasing window	AT1G18075	w	6,220,648	6,220,833	MIR159/MIR159B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	1	w	6,220,813	Phasing window	ath-MIR159b	w	6,220,646	6,220,841	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	37	4,877,516	8	15	38	76
C0F2	8	2,789,465	3	6	14	29
d1F1	2	3,574,742	1	1	3	6
d1F2	2	3,705,660	1	1	3	5
d234F1	22	1,417,116	16	31	78	155
d234F2	128	3,822,319	33	67	167	335
r2F1	79	2,195,923	36	72	180	360
r2F2	198	2,233,522	89	177	443	886
r2FSb	179	5,728,276	31	62	156	312
r2FNaSb	229	5,311,047	43	86	216	431
r2FNa1	148	1,834,656	81	161	403	807
r2FNa2	216	6,081,068	36	71	178	355
r2FL	69	1,145,942	60	120	301	602
r2FD	244	4,928,142	50	99	248	495
C0FCSb	34	9,399,678	4	7	18	36
C0FSb	59	9,361,008	6	13	32	63
r2SC1	40	3,743,342	11	21	53	107
r2SH	38	2,165,395	18	35	88	175
r2SNa1	61	2,082,930	29	59	146	293
r2SC3	172	3,997,922	43	86	215	430
r2SNa2	177	4,617,795	38	77	192	383
r2SSb	129	3,278,680	39	79	197	393
r2SNaSb	62	3,087,212	20	40	100	201
r2SC2	116	476,105	244	487	1,218	2,436
r2SP	47	976,646	48	96	241	481
C0RC1	25	1,249,181	20	40	100	200
C0RNi	26	1,211,490	21	43	107	215
AtCM	225	14,488,208	16	31	78	155
AT_Leaf	631,485	8,047,907	78,466	156,931	392,329	784,657
At_miR1507OX_1	12,144	1,478,373	8,214	16,429	41,072	82,144
At_miR1507OX_2	17,911	1,638,916	10,929	21,857	54,643	109,286
At_miR2109OX_1	12,421	1,760,055	7,057	14,114	35,286	70,572
At_miR2109OX_2	26,306	2,446,954	10,751	21,501	53,753	107,505
At_miR2118aOX_1	8,949	1,212,493	7,381	14,761	36,903	73,807
At_miR2118aOX_2	14,979	1,258,140	11,906	23,811	59,528	119,057
At_miR2118bOX_1	22,973	2,023,619	11,352	22,705	56,762	113,524
At_miR2118bOX_2	12,262	1,733,586	7,073	14,146	35,366	70,732
At_miR2118cOX_1	19,310	1,995,522	9,677	19,353	48,383	96,767
At_miR2118cOX_2	19,892	2,496,180	7,969	15,938	39,845	79,690
At_miROX_control	20,845	1,838,508	11,338	22,676	56,690	113,380
At_miROX_ck_2	18,256	1,804,409	10,117	20,235	50,587	101,174
hen1-8	10,014	5,456,831	1,835	3,670	9,176	18,351
hen1-8 ntp2-1	13,448	6,244,400	2,154	4,307	10,768	21,536
hen1-8 urt1-1	13,661	6,081,292	2,246	4,493	11,232	22,464
hen1-8 ntp4-1	7,946	4,626,878	1,717	3,435	8,587	17,174
hen1-8 ntp5-1	14,763	5,676,073	2,601	5,202	13,005	26,009
hen1-8 ntp6-1	70,512	4,328,718	16,289	32,579	81,447	162,893
hen1-8 ntp7-1	8,421	4,409,080	1,910	3,820	9,550	19,099
hen1-8 ntp8-1	17,227	8,736,008	1,972	3,944	9,860	19,720
hen1-8 ntp10-1	11,026	6,387,459	1,726	3,452	8,631	17,262
hen1-8 r2	4,442	2,874,203	1,545	3,091	7,727	15,455
hen1-8 heso1-1	12,780	6,015,054	2,125	4,249	10,623	21,247
hen1-8 mee44	4,664	3,435,030	1,358	2,716	6,789	13,578
Wt_d	67	7,517,450	9	18	45	89
Col_d	34,188	11,692,099	2,924	5,848	14,620	29,240

Link to FindMiRNA for this sequence