Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTTTACTGCTACTTGTGTTCC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
12w8,432,747Phasing windowath-MIR5012w8,432,6488,432,796miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F252,789,465  24918
d1F133,574,742  1248
d1F203,705,660  0000
d234F141,417,116  361428
d234F2113,822,319  361429
r2F162,195,923  351427
r2F2302,233,522  132767134
r2FSb245,728,276  482142
r2FNaSb245,311,047  592345
r2FNa161,834,656  371633
r2FNa2106,081,068  23816
r2FL21,145,942  23917
r2FD184,928,142  471837
C0FCSb09,399,678  0000
C0FSb19,361,008  1111
r2SC113,743,342  1113
r2SH42,165,395  24918
r2SNa102,082,930  0000
r2SC323,997,922  1135
r2SNa214,617,795  1112
r2SSb33,278,680  1259
r2SNaSb13,087,212  1123
r2SC26476,105  132563126
r2SP2976,646  241020
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM014,488,208  0000
AT_Leaf248,047,907  361530
At_miR1507OX_101,478,373  0000
At_miR1507OX_241,638,916  251224
At_miR2109OX_121,760,055  12611
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_221,258,140  23816
At_miR2118bOX_152,023,619  251225
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_212,496,180  1124
At_miROX_control21,838,508  12511
At_miROX_ck_221,804,409  12611
hen1-8365,456,831  7133366
hen1-8 ntp2-1456,244,400  7143672
hen1-8 urt1-1246,081,292  482039
hen1-8 ntp4-1334,626,878  7143671
hen1-8 ntp5-1515,676,073  9184590
hen1-8 ntp6-11984,328,718  4691229457
hen1-8 ntp7-1304,409,080  7143468
hen1-8 ntp8-1558,736,008  6133163
hen1-8 ntp10-1406,387,459  6133163
hen1-8 r2402,874,203  142870139
hen1-8 heso1-1316,015,054  5102652
hen1-8 mee44283,435,030  8164182
Wt_d137,517,450  23917
Col_d3611,692,099  361531


Link to FindMiRNA for this sequence