Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTTTCTTCTACTTCTTGCACA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w28,635Phasing windowAT1G01040w23,14631,227dicer-like 1

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w28,635Phasing windowAT1G01046w28,50028,706MIR838a; miRNA
31w28,635Phasing windowath-MIR838w28,50028,706miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F213,822,319  1113
r2F102,195,923  0000
r2F292,233,522  482040
r2FSb05,728,276  0000
r2FNaSb25,311,047  1124
r2FNa101,834,656  0000
r2FNa226,081,068  1123
r2FL01,145,942  0000
r2FD14,928,142  1112
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa214,617,795  1112
r2SSb33,278,680  1259
r2SNaSb03,087,212  0000
r2SC212476,105  2550126252
r2SP0976,646  0000
C0RC11001,249,181  80160400801
C0RNi61,211,490  5102550
AtCM314,488,208  1112
AT_Leaf278,047,907  371734
At_miR1507OX_181,478,373  5112754
At_miR1507OX_2121,638,916  7153773
At_miR2109OX_161,760,055  371734
At_miR2109OX_2202,446,954  8164182
At_miR2118aOX_191,212,493  7153774
At_miR2118aOX_291,258,140  7143672
At_miR2118bOX_1172,023,619  8174284
At_miR2118bOX_251,733,586  361429
At_miR2118cOX_1231,995,522  122358115
At_miR2118cOX_2212,496,180  8174284
At_miROX_control191,838,508  102152103
At_miROX_ck_2121,804,409  7133367
hen1-815,456,831  1112
hen1-8 ntp2-126,244,400  1123
hen1-8 urt1-116,081,292  1112
hen1-8 ntp4-114,626,878  1112
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-184,328,718  24918
hen1-8 ntp7-124,409,080  1125
hen1-8 ntp8-118,736,008  1111
hen1-8 ntp10-116,387,459  1112
hen1-8 r202,874,203  0000
hen1-8 heso1-126,015,054  1123
hen1-8 mee4403,435,030  0000
Wt_d147,517,450  24919
Col_d3311,692,099  361428


Link to FindMiRNA for this sequence