Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTTTCTTGGCCCATCCACTTC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
13w6,217,499Phasing windowath-MIR3440bw6,217,4766,217,600miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F203,822,319  0000
r2F102,195,923  0000
r2F212,233,522  1124
r2FSb15,728,276  1112
r2FNaSb05,311,047  0000
r2FNa101,834,656  0000
r2FNa206,081,068  0000
r2FL01,145,942  0000
r2FD04,928,142  0000
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa214,617,795  1112
r2SSb13,278,680  1123
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP0976,646  0000
C0RC1151,249,181  122460120
C0RNi41,211,490  371733
AtCM014,488,208  0000
AT_Leaf18,047,907  1111
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_111,760,055  1136
At_miR2109OX_202,446,954  0000
At_miR2118aOX_131,212,493  251225
At_miR2118aOX_211,258,140  1248
At_miR2118bOX_112,023,619  1125
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_222,496,180  1248
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-116,081,292  1112
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-125,676,073  1124
hen1-8 ntp6-114,328,718  1112
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-118,736,008  1111
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d07,517,450  0000
Col_d311,692,099  1113


Link to FindMiRNA for this sequence