Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: TTTTTCCTACTCCGCCCATACC
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11c4,182,164Phasing windowAT1G12290c4,178,3594,182,593Disease resistance protein (CC-NBS-LRR class) family

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21c4,182,164Phasing windowAT1G12294c4,182,1324,182,299MIR472a; miRNA
31c4,182,164Phasing windowath-MIR472c4,182,1324,182,299miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F232,789,465  12511
d1F103,574,742  0000
d1F203,705,660  0000
d234F121,417,116  13714
d234F243,822,319  12510
r2F172,195,923  361632
r2F222,233,522  1249
r2FSb145,728,276  251224
r2FNaSb75,311,047  13713
r2FNa1101,834,656  5112755
r2FNa216,081,068  1112
r2FL91,145,942  8163979
r2FD54,928,142  12510
C0FCSb09,399,678  0000
C0FSb39,361,008  1123
r2SC133,743,342  1248
r2SH22,165,395  1259
r2SNa102,082,930  0000
r2SC363,997,922  23815
r2SNa224,617,795  1124
r2SSb153,278,680  592346
r2SNaSb63,087,212  241019
r2SC29476,105  193895189
r2SP3976,646  361531
C0RC1301,249,181  2448120240
C0RNi201,211,490  173383165
AtCM014,488,208  0000
AT_Leaf1258,047,907  163178155
At_miR1507OX_1751,478,373  51101254507
At_miR1507OX_21261,638,916  77154384769
At_miR2109OX_1811,760,055  4692230460
At_miR2109OX_22062,446,954  84168421842
At_miR2118aOX_1821,212,493  68135338676
At_miR2118aOX_2811,258,140  64129322644
At_miR2118bOX_11532,023,619  76151378756
At_miR2118bOX_2921,733,586  53106265531
At_miR2118cOX_11581,995,522  79158396792
At_miR2118cOX_21592,496,180  64127318637
At_miROX_control1521,838,508  83165413827
At_miROX_ck_21121,804,409  62124310621
hen1-8105,456,831  24918
hen1-8 ntp2-1116,244,400  24918
hen1-8 urt1-186,081,292  13713
hen1-8 ntp4-164,626,878  13613
hen1-8 ntp5-1175,676,073  361530
hen1-8 ntp6-11514,328,718  3570174349
hen1-8 ntp7-1104,409,080  251123
hen1-8 ntp8-1138,736,008  13715
hen1-8 ntp10-1176,387,459  351327
hen1-8 r262,874,203  241021
hen1-8 heso1-196,015,054  13715
hen1-8 mee4403,435,030  0000
Wt_d207,517,450  351327
Col_d65611,692,099  56112281561


Link to FindMiRNA for this sequence