Moso Bamboo small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: TTGGACTTACCTCGGAGGAAGGC
Length: 23 nucleotides
Number of hits: 329

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	1	w	106	Phasing window	Link to IGR (68,561 bp)			Small region at sequence (3 kb)

Other perfect matches found in genome in addition to that listed above.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	w	241,323	Phasing window	Link to IGR (12,572 bp)			Small region at sequence (3 kb)
3	2	w	1,914,591	Phasing window	Link to IGR (32,829 bp)			Small region at sequence (3 kb)
4	2	c	2,443,925	Phasing window	Link to IGR (10,790 bp)			Small region at sequence (3 kb)
5	2	c	2,444,415	Phasing window	Link to IGR (10,790 bp)			Small region at sequence (3 kb)
6	5	w	239,837	Phasing window	Link to IGR (29,411 bp)			Small region at sequence (3 kb)
7	6	w	1,690,781	Phasing window	Link to IGR (70,892 bp)			Small region at sequence (3 kb)
8	6	w	1,691,296	Phasing window	Link to IGR (70,892 bp)			Small region at sequence (3 kb)
9	7	w	487,085	Phasing window	Link to IGR (64,485 bp)			Small region at sequence (3 kb)
10	8	c	1,013,291	Phasing window	Link to IGR (19,914 bp)			Small region at sequence (3 kb)
11	8	w	1,611,216	Phasing window	Link to IGR (43,818 bp)			Small region at sequence (3 kb)
12	10	w	1,075,772	Phasing window	Link to IGR (36,763 bp)			Small region at sequence (3 kb)
13	10	w	1,761,869	Phasing window	Link to IGR (18,438 bp)			Small region at sequence (3 kb)
14	10	w	1,762,316	Phasing window	Link to IGR (18,438 bp)			Small region at sequence (3 kb)
15	11	w	1,105,345	Phasing window	Link to IGR (50,687 bp)			Small region at sequence (3 kb)
16	11	c	1,314,387	Phasing window	Link to IGR (28,240 bp)			Small region at sequence (3 kb)
17	12	w	1,154,993	Phasing window	Link to IGR (51,684 bp)			Small region at sequence (3 kb)
18	13	w	713,708	Phasing window	Link to IGR (48,171 bp)			Small region at sequence (3 kb)
19	27	w	678,479	Phasing window	Link to IGR (326,976 bp)			Small region at sequence (3 kb)
20	29	c	1,710,008	Phasing window	Link to IGR (23,421 bp)			Small region at sequence (3 kb)
21	34	w	1,610,165	Phasing window	Link to IGR (50,902 bp)			Small region at sequence (3 kb)
22	42	w	920,443	Phasing window	Link to IGR (67,587 bp)			Small region at sequence (3 kb)
23	47	c	137,747	Phasing window	Link to IGR (70,122 bp)			Small region at sequence (3 kb)
24	47	c	402,838	Phasing window	Link to IGR (47,449 bp)			Small region at sequence (3 kb)
25	48	w	608,417	Phasing window	Link to IGR (28,096 bp)			Small region at sequence (3 kb)
26	56	w	1,031,244	Phasing window	Link to IGR (70,913 bp)			Small region at sequence (3 kb)
27	58	w	920,548	Phasing window	Link to IGR (87,088 bp)			Small region at sequence (3 kb)
28	62	w	1,015,893	Phasing window	Link to IGR (19,224 bp)			Small region at sequence (3 kb)
29	63	c	786,193	Phasing window	Link to IGR (58,790 bp)			Small region at sequence (3 kb)
30	63	c	869,160	Phasing window	Link to IGR (28,566 bp)			Small region at sequence (3 kb)
31	64	w	1,079,515	Phasing window	Link to IGR (49,775 bp)			Small region at sequence (3 kb)
32	76	w	1,072,432	Phasing window	Link to IGR (17,982 bp)			Small region at sequence (3 kb)
33	78	w	814,684	Phasing window	Link to IGR (41,635 bp)			Small region at sequence (3 kb)
34	87	w	214,593	Phasing window	Link to IGR (70,621 bp)			Small region at sequence (3 kb)
35	90	w	409,727	Phasing window	Link to IGR (32,093 bp)			Small region at sequence (3 kb)
36	104	w	346,554	Phasing window	Link to IGR (132,320 bp)			Small region at sequence (3 kb)
37	106	c	507,709	Phasing window	Link to IGR (67,497 bp)			Small region at sequence (3 kb)
38	113	c	323,442	Phasing window	Link to IGR (40,424 bp)			Small region at sequence (3 kb)
39	115	c	527,747	Phasing window	Link to IGR (94,021 bp)			Small region at sequence (3 kb)
40	118	w	345,058	Phasing window	Link to IGR (20,769 bp)			Small region at sequence (3 kb)
41	126	c	189,745	Phasing window	Link to IGR (211,351 bp)			Small region at sequence (3 kb)
42	129	c	153,927	Phasing window	Link to IGR (42,733 bp)			Small region at sequence (3 kb)
43	131	w	318,869	Phasing window	Link to IGR (198,049 bp)			Small region at sequence (3 kb)
44	141	c	168,922	Phasing window	Link to IGR (46,420 bp)			Small region at sequence (3 kb)
45	148	w	632,503	Phasing window	Link to IGR (191,788 bp)			Small region at sequence (3 kb)
46	149	c	220,337	Phasing window	Link to IGR (75,336 bp)			Small region at sequence (3 kb)
47	153	c	473,709	Phasing window	Link to IGR (137,704 bp)			Small region at sequence (3 kb)
48	155	w	391,033	Phasing window	Link to IGR (64,137 bp)			Small region at sequence (3 kb)
49	157	w	885,756	Phasing window	Link to IGR (72,198 bp)			Small region at sequence (3 kb)
50	160	w	853,558	Phasing window	Link to IGR (89,385 bp)			Small region at sequence (3 kb)
51	161	w	237,390	Phasing window	Link to IGR (70,609 bp)			Small region at sequence (3 kb)
52	165	w	399,103	Phasing window	Link to IGR (95,099 bp)			Small region at sequence (3 kb)
53	169	w	35,146	Phasing window	Link to IGR (214,383 bp)			Small region at sequence (3 kb)
54	169	c	199,602	Phasing window	Link to IGR (214,383 bp)			Small region at sequence (3 kb)
55	172	c	208,869	Phasing window	Link to IGR (92,527 bp)			Small region at sequence (3 kb)
56	174	w	342,484	Phasing window	Link to IGR (57,149 bp)			Small region at sequence (3 kb)
57	184	w	246,635	Phasing window	Link to IGR (140,463 bp)			Small region at sequence (3 kb)
58	195	w	500,152	Phasing window	Link to IGR (78,418 bp)			Small region at sequence (3 kb)
59	207	c	46,080	Phasing window	Link to IGR (68,931 bp)			Small region at sequence (3 kb)
60	207	c	46,562	Phasing window	Link to IGR (68,931 bp)			Small region at sequence (3 kb)
61	214	w	620,145	Phasing window	Link to IGR (70,389 bp)			Small region at sequence (3 kb)
62	218	w	154,171	Phasing window	Link to IGR (104,116 bp)			Small region at sequence (3 kb)
63	232	w	894,668	Phasing window	Link to IGR (622,296 bp)			Small region at sequence (3 kb)
64	240	c	666,759	Phasing window	Link to IGR (74,030 bp)			Small region at sequence (3 kb)
65	241	w	513,497	Phasing window	Link to IGR (113,919 bp)			Small region at sequence (3 kb)
66	248	w	713,985	Phasing window	Link to IGR (267,894 bp)			Small region at sequence (3 kb)
67	248	w	722,753	Phasing window	Link to IGR (267,894 bp)			Small region at sequence (3 kb)
68	249	w	171,572	Phasing window	Link to IGR (133,024 bp)			Small region at sequence (3 kb)
69	251	c	31,003	Phasing window	Link to IGR (41,158 bp)			Small region at sequence (3 kb)
70	256	w	203,964	Phasing window	Link to IGR (23,010 bp)			Small region at sequence (3 kb)
71	259	w	101,509	Phasing window	Link to IGR (52,799 bp)			Small region at sequence (3 kb)
72	277	w	15,819	Phasing window	Link to IGR (184,873 bp)			Small region at sequence (3 kb)
73	289	c	492,165	Phasing window	Link to IGR (17,987 bp)			Small region at sequence (3 kb)
74	290	c	545,266	Phasing window	Link to IGR (95,532 bp)			Small region at sequence (3 kb)
75	290	c	545,714	Phasing window	Link to IGR (95,532 bp)			Small region at sequence (3 kb)
76	301	c	523,500	Phasing window	Link to IGR (42,517 bp)			Small region at sequence (3 kb)
77	321	c	195,241	Phasing window	Link to IGR (35,692 bp)			Small region at sequence (3 kb)
78	350	w	60,303	Phasing window	Link to IGR (36,534 bp)			Small region at sequence (3 kb)
79	357	w	656,879	Phasing window	Link to IGR (29,473 bp)			Small region at sequence (3 kb)
80	360	c	156,647	Phasing window	Link to IGR (30,146 bp)			Small region at sequence (3 kb)
81	362	c	37,433	Phasing window	Link to IGR (175,379 bp)			Small region at sequence (3 kb)
82	367	w	631,740	Phasing window	Link to IGR (80,888 bp)			Small region at sequence (3 kb)
83	374	c	188,214	Phasing window	Link to IGR (62,661 bp)			Small region at sequence (3 kb)
84	381	w	416,352	Phasing window	Link to IGR (120,566 bp)			Small region at sequence (3 kb)
85	384	w	277,157	Phasing window	Link to IGR (31,191 bp)			Small region at sequence (3 kb)
86	395	c	460,955	Phasing window	Link to IGR (77,466 bp)			Small region at sequence (3 kb)
87	408	w	320,479	Phasing window	Link to IGR (75,479 bp)			Small region at sequence (3 kb)
88	415	c	611,148	Phasing window	Link to IGR (56,020 bp)			Small region at sequence (3 kb)
89	420	c	303,412	Phasing window	Link to IGR (289,736 bp)			Small region at sequence (3 kb)
90	428	c	567,067	Phasing window	Link to IGR (49,387 bp)			Small region at sequence (3 kb)
91	431	c	212,244	Phasing window	Link to IGR (67,056 bp)			Small region at sequence (3 kb)
92	437	c	493,251	Phasing window	Link to IGR (11,521 bp)			Small region at sequence (3 kb)
93	481	w	594,540	Phasing window	Link to IGR (98,308 bp)			Small region at sequence (3 kb)
94	488	w	669,553	Phasing window	Link to IGR (79,544 bp)			Small region at sequence (3 kb)
95	491	w	5,508	Phasing window	Link to IGR (38,924 bp)			Small region at sequence (3 kb)
96	498	w	440,635	Phasing window	Link to IGR (23,939 bp)			Small region at sequence (3 kb)
97	504	w	517,298	Phasing window	Link to IGR (153,462 bp)			Small region at sequence (3 kb)
98	520	w	486,524	Phasing window	Link to IGR (257,527 bp)			Small region at sequence (3 kb)
99	531	c	85,270	Phasing window	Link to IGR (37,086 bp)			Small region at sequence (3 kb)
100	562	w	2,764	Phasing window	Link to IGR (27,023 bp)			Small region at sequence (3 kb)
101	565	c	250,882	Phasing window	Link to IGR (48,386 bp)			Small region at sequence (3 kb)
102	574	w	327,579	Phasing window	Link to IGR (236,744 bp)			Small region at sequence (3 kb)
103	574	w	337,368	Phasing window	Link to IGR (236,744 bp)			Small region at sequence (3 kb)
104	598	c	254,000	Phasing window	Link to IGR (118,592 bp)			Small region at sequence (3 kb)
105	606	w	349,594	Phasing window	Link to IGR (52,692 bp)			Small region at sequence (3 kb)
106	609	w	422,536	Phasing window	Link to IGR (24,478 bp)			Small region at sequence (3 kb)
107	620	w	54,780	Phasing window	Link to IGR (81,400 bp)			Small region at sequence (3 kb)
108	637	c	208,148	Phasing window	Link to IGR (46,082 bp)			Small region at sequence (3 kb)
109	639	w	122,458	Phasing window	Link to IGR (50,536 bp)			Small region at sequence (3 kb)
110	644	c	38,329	Phasing window	Link to IGR (163,518 bp)			Small region at sequence (3 kb)
111	666	w	217,894	Phasing window	Link to IGR (82,969 bp)			Small region at sequence (3 kb)
112	669	w	164,316	Phasing window	Link to IGR (73,951 bp)			Small region at sequence (3 kb)
113	707	c	306,079	Phasing window	Link to IGR (82,020 bp)			Small region at sequence (3 kb)
114	707	c	364,131	Phasing window	Link to IGR (82,020 bp)			Small region at sequence (3 kb)
115	716	c	425,567	Phasing window	Link to IGR (20,969 bp)			Small region at sequence (3 kb)
116	733	w	453,729	Phasing window	Link to IGR (29,007 bp)			Small region at sequence (3 kb)
117	741	w	367,859	Phasing window	Link to IGR (188,115 bp)			Small region at sequence (3 kb)
118	741	w	376,595	Phasing window	Link to IGR (188,115 bp)			Small region at sequence (3 kb)
119	754	c	542,483	Phasing window	Link to IGR (26,455 bp)			Small region at sequence (3 kb)
120	759	w	217,097	Phasing window	Link to IGR (95,066 bp)			Small region at sequence (3 kb)
121	801	w	136,687	Phasing window	Link to IGR (48,134 bp)			Small region at sequence (3 kb)
122	823	c	197,513	Phasing window	Link to IGR (131,404 bp)			Small region at sequence (3 kb)
123	852	c	130,243	Phasing window	Link to IGR (128,805 bp)			Small region at sequence (3 kb)
124	865	w	176,941	Phasing window	Link to IGR (77,058 bp)			Small region at sequence (3 kb)
125	865	c	277,940	Phasing window	Link to IGR (44,978 bp)			Small region at sequence (3 kb)
126	867	c	254,209	Phasing window	Link to IGR (322,844 bp)			Small region at sequence (3 kb)
127	870	w	271,996	Phasing window	Link to IGR (108,845 bp)			Small region at sequence (3 kb)
128	875	w	227,532	Phasing window	Link to IGR (14,726 bp)			Small region at sequence (3 kb)
129	883	w	210,800	Phasing window	Link to IGR (55,049 bp)			Small region at sequence (3 kb)
130	903	c	149,038	Phasing window	Link to IGR (115,784 bp)			Small region at sequence (3 kb)
131	905	c	277,156	Phasing window	Link to IGR (40,299 bp)			Small region at sequence (3 kb)
132	914	w	238,821	Phasing window	Link to IGR (34,863 bp)			Small region at sequence (3 kb)
133	922	w	362,449	Phasing window	Link to IGR (59,156 bp)			Small region at sequence (3 kb)
134	939	c	153,176	Phasing window	Link to IGR (164,528 bp)			Small region at sequence (3 kb)
135	942	w	108,124	Phasing window	Link to IGR (79,794 bp)			Small region at sequence (3 kb)
136	954	c	365,280	Phasing window	Link to IGR (77,880 bp)			Small region at sequence (3 kb)
137	961	w	283,440	Phasing window	Link to IGR (71,416 bp)			Small region at sequence (3 kb)
138	1000	w	336,944	Phasing window	Link to IGR (132,559 bp)			Small region at sequence (3 kb)
139	1005	c	179,824	Phasing window	Link to IGR (30,352 bp)			Small region at sequence (3 kb)
140	1015	c	433,879	Phasing window	Link to IGR (7,207 bp)			Small region at sequence (3 kb)
141	1045	w	103,389	Phasing window	Link to IGR (289,357 bp)			Small region at sequence (3 kb)
142	1061	w	361,396	Phasing window	Link to IGR (366,977 bp)			Small region at sequence (3 kb)
143	1063	w	96,499	Phasing window	Link to IGR (9,973 bp)			Small region at sequence (3 kb)
144	1077	c	395,729	Phasing window	Link to IGR (158,571 bp)			Small region at sequence (3 kb)
145	1077	c	424,213	Phasing window	Link to IGR (158,571 bp)			Small region at sequence (3 kb)
146	1104	w	48,259	Phasing window	Link to IGR (179,729 bp)			Small region at sequence (3 kb)
147	1112	w	56,560	Phasing window	Link to IGR (44,233 bp)			Small region at sequence (3 kb)
148	1113	w	118,947	Phasing window	Link to IGR (5,835 bp)			Small region at sequence (3 kb)
149	1115	w	303,548	Phasing window	Link to IGR (32,113 bp)			Small region at sequence (3 kb)
150	1138	c	164,138	Phasing window	Link to IGR (41,418 bp)			Small region at sequence (3 kb)
151	1159	c	53,271	Phasing window	Link to IGR (36,934 bp)			Small region at sequence (3 kb)
152	1169	w	47,553	Phasing window	Link to IGR (30,285 bp)			Small region at sequence (3 kb)
153	1175	c	266,041	Phasing window	Link to IGR (26,533 bp)			Small region at sequence (3 kb)
154	1219	c	334,993	Phasing window	Link to IGR (65,845 bp)			Small region at sequence (3 kb)
155	1235	c	265,834	Phasing window	Link to IGR (28,559 bp)			Small region at sequence (3 kb)
156	1243	c	68,910	Phasing window	Link to IGR (153,371 bp)			Small region at sequence (3 kb)
157	1244	w	364,470	Phasing window	Link to IGR (69,886 bp)			Small region at sequence (3 kb)
158	1286	w	183,109	Phasing window	Link to IGR (144,028 bp)			Small region at sequence (3 kb)
159	1338	w	307,680	Phasing window	Link to IGR (151,848 bp)			Small region at sequence (3 kb)
160	1355	w	114,035	Phasing window	Link to IGR (141,086 bp)			Small region at sequence (3 kb)
161	1363	w	919	Phasing window	Link to IGR (45,933 bp)			Small region at sequence (3 kb)
162	1378	c	332,140	Phasing window	Link to IGR (30,612 bp)			Small region at sequence (3 kb)
163	1406	w	124,370	Phasing window	Link to IGR (82,701 bp)			Small region at sequence (3 kb)
164	1420	c	67,909	Phasing window	Link to IGR (18,022 bp)			Small region at sequence (3 kb)
165	1425	w	47,152	Phasing window	Link to IGR (58,901 bp)			Small region at sequence (3 kb)
166	1459	w	197,954	Phasing window	Link to IGR (42,839 bp)			Small region at sequence (3 kb)
167	1482	w	302,836	Phasing window	Link to IGR (80,877 bp)			Small region at sequence (3 kb)
168	1634	w	82,607	Phasing window	Link to IGR (42,970 bp)			Small region at sequence (3 kb)
169	1662	w	101,869	Phasing window	Link to IGR (78,149 bp)			Small region at sequence (3 kb)
170	1732	w	142,865	Phasing window	Link to IGR (209,110 bp)			Small region at sequence (3 kb)
171	1784	w	100,083	Phasing window	Link to IGR (76,637 bp)			Small region at sequence (3 kb)
172	1786	c	32,604	Phasing window	Link to IGR (41,180 bp)			Small region at sequence (3 kb)
173	1792	w	52,003	Phasing window	Link to IGR (30,234 bp)			Small region at sequence (3 kb)
174	1796	w	236,974	Phasing window	Link to IGR (50,698 bp)			Small region at sequence (3 kb)
175	1825	w	191,218	Phasing window	Link to IGR (173,197 bp)			Small region at sequence (3 kb)
176	1875	w	60,819	Phasing window	Link to IGR (164,421 bp)			Small region at sequence (3 kb)
177	1897	w	149,143	Phasing window	Link to IGR (37,502 bp)			Small region at sequence (3 kb)
178	1941	c	184,712	Phasing window	Link to IGR (37,497 bp)			Small region at sequence (3 kb)
179	1943	c	49,431	Phasing window	Link to IGR (115,349 bp)			Small region at sequence (3 kb)
180	1994	w	236,333	Phasing window	Link to IGR (80,902 bp)			Small region at sequence (3 kb)
181	1996	w	115,913	Phasing window	Link to IGR (102,993 bp)			Small region at sequence (3 kb)
182	2008	w	86,701	Phasing window	Link to IGR (194,633 bp)			Small region at sequence (3 kb)
183	2008	w	88,404	Phasing window	Link to IGR (194,633 bp)			Small region at sequence (3 kb)
184	2008	w	99,615	Phasing window	Link to IGR (194,633 bp)			Small region at sequence (3 kb)
185	2049	w	128,334	Phasing window	Link to IGR (24,019 bp)			Small region at sequence (3 kb)
186	2055	w	152,285	Phasing window	Link to IGR (67,354 bp)			Small region at sequence (3 kb)
187	2055	w	156,556	Phasing window	PH01002055G0240	w	156,144	164,752	unknown function
188	2056	c	48,452	Phasing window	Link to IGR (143,719 bp)			Small region at sequence (3 kb)
189	2064	c	43,082	Phasing window	Link to IGR (34,268 bp)			Small region at sequence (3 kb)
190	2106	c	102,029	Phasing window	Link to IGR (39,531 bp)			Small region at sequence (3 kb)
191	2130	w	188,082	Phasing window	Link to IGR (117,668 bp)			Small region at sequence (3 kb)
192	2160	w	129,707	Phasing window	Link to IGR (41,601 bp)			Small region at sequence (3 kb)
193	2192	c	66,081	Phasing window	Link to IGR (111,827 bp)			Small region at sequence (3 kb)
194	2211	w	109,663	Phasing window	Link to IGR (116,900 bp)			Small region at sequence (3 kb)
195	2246	w	179,504	Phasing window	Link to IGR (33,059 bp)			Small region at sequence (3 kb)
196	2247	c	113,258	Phasing window	Link to IGR (180,228 bp)			Small region at sequence (3 kb)
197	2290	w	183,524	Phasing window	Link to IGR (74,050 bp)			Small region at sequence (3 kb)
198	2314	w	1,951	Phasing window	Link to IGR (51,257 bp)			Small region at sequence (3 kb)
199	2314	c	135,151	Phasing window	Link to IGR (35,505 bp)			Small region at sequence (3 kb)
200	2317	w	118,667	Phasing window	Link to IGR (12,870 bp)			Small region at sequence (3 kb)
201	2392	w	136,758	Phasing window	Link to IGR (24,252 bp)			Small region at sequence (3 kb)
202	2445	w	161,901	Phasing window	Link to IGR (45,341 bp)			Small region at sequence (3 kb)
203	2459	c	206,373	Phasing window	Link to IGR (44,079 bp)			Small region at sequence (3 kb)
204	2508	w	100,134	Phasing window	Link to IGR (75,515 bp)			Small region at sequence (3 kb)
205	2530	c	105,849	Phasing window	Link to IGR (101,513 bp)			Small region at sequence (3 kb)
206	2538	w	136,819	Phasing window	Link to IGR (46,669 bp)			Small region at sequence (3 kb)
207	2549	c	207,966	Phasing window	Link to IGR (89,672 bp)			Small region at sequence (3 kb)
208	2597	c	187,806	Phasing window	Link to IGR (32,331 bp)			Small region at sequence (3 kb)
209	2623	c	76,666	Phasing window	Link to IGR (18,583 bp)			Small region at sequence (3 kb)
210	2725	c	82,494	Phasing window	Link to IGR (41,705 bp)			Small region at sequence (3 kb)
211	2815	c	163,278	Phasing window	Link to IGR (127,905 bp)			Small region at sequence (3 kb)
212	2984	w	125,495	Phasing window	Link to IGR (54,784 bp)			Small region at sequence (3 kb)
213	3086	c	158,934	Phasing window	Link to IGR (31,165 bp)			Small region at sequence (3 kb)
214	3104	c	110,879	Phasing window	Link to IGR (172,472 bp)			Small region at sequence (3 kb)
215	3160	c	147,223	Phasing window	Link to IGR (104,536 bp)			Small region at sequence (3 kb)
216	3237	c	155,044	Phasing window	Link to IGR (9,849 bp)			Small region at sequence (3 kb)
217	3287	w	8,573	Phasing window	Link to IGR (160,420 bp)			Small region at sequence (3 kb)
218	3307	c	158,113	Phasing window	Link to IGR (159,195 bp)			Small region at sequence (3 kb)
219	3401	w	71,764	Phasing window	Link to IGR (42,938 bp)			Small region at sequence (3 kb)
220	3429	c	67,307	Phasing window	Link to IGR (29,572 bp)			Small region at sequence (3 kb)
221	3473	c	2,329	Phasing window	Link to IGR (66,376 bp)			Small region at sequence (3 kb)
222	3480	w	27,530	Phasing window	Link to IGR (42,431 bp)			Small region at sequence (3 kb)
223	3595	c	28,226	Phasing window	Link to IGR (64,432 bp)			Small region at sequence (3 kb)
224	3619	c	66,351	Phasing window	Link to IGR (76,459 bp)			Small region at sequence (3 kb)
225	3688	w	115,733	Phasing window	Link to IGR (103,796 bp)			Small region at sequence (3 kb)
226	3709	c	9,124	Phasing window	Link to IGR (106,691 bp)			Small region at sequence (3 kb)
227	3710	c	80,206	Phasing window	Link to IGR (61,952 bp)			Small region at sequence (3 kb)
228	3786	c	128,152	Phasing window	Link to IGR (7,151 bp)			Small region at sequence (3 kb)
229	3807	w	71,820	Phasing window	Link to IGR (46,790 bp)			Small region at sequence (3 kb)
230	3814	c	121,086	Phasing window	Link to IGR (129,546 bp)			Small region at sequence (3 kb)
231	3821	c	5,012	Phasing window	Link to IGR (84,904 bp)			Small region at sequence (3 kb)
232	4129	w	29,047	Phasing window	Link to IGR (58,225 bp)			Small region at sequence (3 kb)
233	4191	w	50,355	Phasing window	Link to IGR (95,758 bp)			Small region at sequence (3 kb)
234	4261	w	25,599	Phasing window	Link to IGR (106,539 bp)			Small region at sequence (3 kb)
235	4264	w	40,383	Phasing window	Link to IGR (106,443 bp)			Small region at sequence (3 kb)
236	4616	c	52,215	Phasing window	Link to IGR (52,419 bp)			Small region at sequence (3 kb)
237	4627	w	55,887	Phasing window	Link to IGR (46,518 bp)			Small region at sequence (3 kb)
238	4649	w	65	Phasing window	Link to IGR (89,788 bp)			Small region at sequence (3 kb)
239	4659	c	30,832	Phasing window	Link to IGR (29,867 bp)			Small region at sequence (3 kb)
240	4820	c	5,097	Phasing window	Link to IGR (36,071 bp)			Small region at sequence (3 kb)
241	4867	w	4,591	Phasing window	Link to IGR (47,885 bp)			Small region at sequence (3 kb)
242	4867	w	13,205	Phasing window	Link to IGR (47,885 bp)			Small region at sequence (3 kb)
243	4950	c	72,737	Phasing window	Link to IGR (52,347 bp)			Small region at sequence (3 kb)
244	5063	c	63,774	Phasing window	Link to IGR (75,010 bp)			Small region at sequence (3 kb)
245	5173	w	51,434	Phasing window	Link to IGR (66,686 bp)			Small region at sequence (3 kb)
246	5184	c	48,642	Phasing window	Link to IGR (36,840 bp)			Small region at sequence (3 kb)
247	5216	c	9,880	Phasing window	Link to IGR (69,832 bp)			Small region at sequence (3 kb)
248	5243	w	53,195	Phasing window	Link to IGR (29,776 bp)			Small region at sequence (3 kb)
249	5403	w	2,023	Phasing window	Link to IGR (43,699 bp)			Small region at sequence (3 kb)
250	5666	w	18,139	Phasing window	Link to IGR (57,611 bp)			Small region at sequence (3 kb)
251	5686	w	7,873	Phasing window	Link to IGR (56,940 bp)			Small region at sequence (3 kb)
252	5930	w	2,015	Phasing window	Link to IGR (51,199 bp)			Small region at sequence (3 kb)
253	6135	w	6,718	Phasing window	Link to IGR (46,498 bp)			Small region at sequence (3 kb)
254	6313	c	41,756	Phasing window	Link to IGR (4,082 bp)			Small region at sequence (3 kb)
255	6510	c	15,768	Phasing window	Link to IGR (38,405 bp)			Small region at sequence (3 kb)
256	6931	w	17,617	Phasing window	Link to IGR (27,417 bp)			Small region at sequence (3 kb)
257	7091	w	4,314	Phasing window	Link to IGR (29,018 bp)			Small region at sequence (3 kb)
258	7702	w	17,707	Phasing window	Link to IGR (20,905 bp)			Small region at sequence (3 kb)
259	8563	w	3,853	Phasing window	Link to IGR (13,622 bp)			Small region at sequence (3 kb)
260	9614	w	4,949	Phasing window	Link to IGR (9,447 bp)			Small region at sequence (3 kb)
261	10994	c	457	Phasing window	Link to IGR (5,855 bp)			Small region at sequence (3 kb)
262	11300	w	1,590	Phasing window	Link to IGR (5,431 bp)			Small region at sequence (3 kb)
263	13490	w	2,122	Phasing window	Link to IGR (4,003 bp)			Small region at sequence (3 kb)
264	14379	c	2,343	Phasing window	Link to IGR (3,706 bp)			Small region at sequence (3 kb)
265	14940	w	2,374	Phasing window	Link to IGR (3,552 bp)			Small region at sequence (3 kb)
266	15420	c	3,215	Phasing window	Link to IGR (3,436 bp)			Small region at sequence (3 kb)
267	15757	w	1,739	Phasing window	Link to IGR (3,363 bp)			Small region at sequence (3 kb)
268	17034	w	2,437	Phasing window	Link to IGR (3,120 bp)			Small region at sequence (3 kb)
269	18806	c	650	Phasing window	Link to IGR (2,874 bp)			Small region at sequence (3 kb)
270	18809	w	1,506	Phasing window	Link to IGR (2,874 bp)			Small region at sequence (3 kb)
271	20118	c	395	Phasing window	Link to IGR (2,734 bp)			Small region at sequence (3 kb)
272	20532	c	51	Phasing window	Link to IGR (2,697 bp)			Small region at sequence (3 kb)
273	21409	c	1,629	Phasing window	Link to IGR (2,623 bp)			Small region at sequence (3 kb)
274	23131	c	742	Phasing window	Link to IGR (2,493 bp)			Small region at sequence (3 kb)
275	23423	c	1,240	Phasing window	Link to IGR (2,472 bp)			Small region at sequence (3 kb)
276	23733	w	1,027	Phasing window	Link to IGR (2,449 bp)			Small region at sequence (3 kb)
277	27686	w	1,715	Phasing window	Link to IGR (2,234 bp)			Small region at sequence (3 kb)
278	29452	c	153	Phasing window	Link to IGR (2,160 bp)			Small region at sequence (3 kb)
279	29710	w	1,924	Phasing window	Link to IGR (2,148 bp)			Small region at sequence (3 kb)
280	34144	w	91	Phasing window	Link to IGR (1,974 bp)			Small region at sequence (3 kb)
281	34706	w	131	Phasing window	Link to IGR (1,955 bp)			Small region at sequence (3 kb)
282	35448	w	1,745	Phasing window	Link to IGR (1,932 bp)			Small region at sequence (3 kb)
283	35460	w	1,672	Phasing window	Link to IGR (1,932 bp)			Small region at sequence (3 kb)
284	37078	c	31	Phasing window	Link to IGR (1,889 bp)			Small region at sequence (3 kb)
285	40297	c	140	Phasing window	Link to IGR (1,819 bp)			Small region at sequence (3 kb)
286	42831	c	1,134	Phasing window	Link to IGR (1,768 bp)			Small region at sequence (3 kb)
287	44346	c	621	Phasing window	Link to IGR (1,734 bp)			Small region at sequence (3 kb)
288	45414	w	1,342	Phasing window	Link to IGR (1,709 bp)			Small region at sequence (3 kb)
289	48628	c	379	Phasing window	Link to IGR (1,628 bp)			Small region at sequence (3 kb)
290	54851	c	351	Phasing window	Link to IGR (1,510 bp)			Small region at sequence (3 kb)
291	61463	w	226	Phasing window	Link to IGR (1,445 bp)			Small region at sequence (3 kb)
292	64811	w	1,103	Phasing window	Link to IGR (1,419 bp)			Small region at sequence (3 kb)
293	65308	c	1,032	Phasing window	Link to IGR (1,415 bp)			Small region at sequence (3 kb)
294	66937	c	343	Phasing window	Link to IGR (1,402 bp)			Small region at sequence (3 kb)
295	69995	c	1,179	Phasing window	Link to IGR (1,377 bp)			Small region at sequence (3 kb)
296	72773	c	1,241	Phasing window	Link to IGR (1,351 bp)			Small region at sequence (3 kb)
297	72847	w	78	Phasing window	Link to IGR (1,350 bp)			Small region at sequence (3 kb)
298	76624	c	433	Phasing window	Link to IGR (1,306 bp)			Small region at sequence (3 kb)
299	78206	w	189	Phasing window	Link to IGR (1,284 bp)			Small region at sequence (3 kb)
300	87751	c	876	Phasing window	Link to IGR (1,141 bp)			Small region at sequence (3 kb)
301	89365	c	71	Phasing window	Link to IGR (1,124 bp)			Small region at sequence (3 kb)
302	94076	w	964	Phasing window	Link to IGR (1,087 bp)			Small region at sequence (3 kb)
303	96602	c	524	Phasing window	Link to IGR (1,073 bp)			Small region at sequence (3 kb)
304	98900	c	25	Phasing window	Link to IGR (1,063 bp)			Small region at sequence (3 kb)
305	100152	c	84	Phasing window	Link to IGR (1,058 bp)			Small region at sequence (3 kb)
306	101919	w	142	Phasing window	Link to IGR (1,052 bp)			Small region at sequence (3 kb)
307	104770	w	152	Phasing window	Link to IGR (1,045 bp)			Small region at sequence (3 kb)
308	126339	c	879	Phasing window	Link to IGR (1,004 bp)			Small region at sequence (3 kb)
309	130627	w	99	Phasing window	Link to IGR (997 bp)			Small region at sequence (3 kb)
310	132059	w	47	Phasing window	Link to IGR (994 bp)			Small region at sequence (3 kb)
311	142737	w	421	Phasing window	Link to IGR (966 bp)			Small region at sequence (3 kb)
312	145425	w	504	Phasing window	Link to IGR (952 bp)			Small region at sequence (3 kb)
313	153116	w	65	Phasing window	Link to IGR (884 bp)			Small region at sequence (3 kb)
314	159963	w	290	Phasing window	Link to IGR (807 bp)			Small region at sequence (3 kb)
315	166010	c	336	Phasing window	Link to IGR (754 bp)			Small region at sequence (3 kb)
316	173134	c	429	Phasing window	Link to IGR (712 bp)			Small region at sequence (3 kb)
317	174236	w	341	Phasing window	Link to IGR (706 bp)			Small region at sequence (3 kb)
318	174490	c	430	Phasing window	Link to IGR (705 bp)			Small region at sequence (3 kb)
319	184569	c	282	Phasing window	Link to IGR (667 bp)			Small region at sequence (3 kb)
320	201092	c	219	Phasing window	Link to IGR (626 bp)			Small region at sequence (3 kb)
321	216163	w	17	Phasing window	Link to IGR (604 bp)			Small region at sequence (3 kb)
322	236886	w	136	Phasing window	Link to IGR (582 bp)			Small region at sequence (3 kb)
323	252416	c	375	Phasing window	Link to IGR (563 bp)			Small region at sequence (3 kb)
324	262478	c	303	Phasing window	Link to IGR (543 bp)			Small region at sequence (3 kb)
325	263077	w	74	Phasing window	Link to IGR (542 bp)			Small region at sequence (3 kb)
326	271497	w	419	Phasing window	Link to IGR (521 bp)			Small region at sequence (3 kb)
327	273425	w	136	Phasing window	Link to IGR (516 bp)			Small region at sequence (3 kb)
328	273909	w	100	Phasing window	Link to IGR (515 bp)			Small region at sequence (3 kb)
329	278545	c	1,551,175	Phasing window	Link to IGR (21,373 bp)			Small region at sequence (3 kb)

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Separator	Normalization Denominator
Data type	Raw	Total	Separator	15M
Bamboo_lf	0	25,598,663	Separator	0
Bamboo_st	0	27,290,413	Separator	0
Bamboo_rt	0	8,658,669	Separator	0
Bam_Leaf	0	15,415,831	Separator	0
Bam_F1	0	18,357,737	Separator	0
Bam_F2	0	12,305,579	Separator	0
Bam_F3	0	13,787,128	Separator	0
Bam_F4	1	13,342,446	Separator	1