The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.
Sequence: GCAGCCCGGAAAGGAAGAGCT
Length: 21 nucleotides
Number of hits: 1
| # | Chr | Strand | Coordinate | Phasing Analysis | Gene | Gene strand | Gene start | Gene stop | Gene function |
|---|---|---|---|---|---|---|---|---|---|
| 1 | 9 | c | 98,404,447 | Phasing window | NbL09g16070 | c | 98,403,124 | 98,405,901 | Nicotiana tabacum ankyrin repeat-containing protein At5g02620-like (LOC107804847), mRNA (XM_016628784.1,XP_016484270.1) |
SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.
| Raw Data | Normalization Denominator | |||
|---|---|---|---|---|
| Data type | Raw | Total | 10M | 25Bm_Sat | 0 | 900,692 | 0 | Nben_Flr_a | 0 | 6,835,485 | 0 | Nben_Flr_b | 0 | 14,515,135 | 0 | Nben_Stem_a | 0 | 2,237,218 | 0 | Nben_Stem_b | 0 | 11,459,664 | 0 | Nben_Root_a | 0 | 3,382,498 | 0 | Nben_Root_b | 0 | 4,855,847 | 0 | Nben_Leaf_a | 0 | 3,450,574 | 0 | Nben_Leaf_b | 0 | 2,865,988 | 0 | Nben_Seedling_a | 0 | 3,370,346 | 0 | Nben_Seedling_b | 0 | 8,891,749 | 0 | NBen_LeafBTI | 0 | 2,124,862 | 0 | 25Bm | 0 | 1,875,367 | 0 | 25Mock | 0 | 15,007,443 | 0 | 18Bm_Sat | 0 | 1,141,536 | 0 | 18Bm | 0 | 1,387,039 | 0 | 18Mock | 0 | 15,274,479 | 0 | cym19s_i | 0 | 3,557,416 | 0 | cym19s_ip | 0 | 450,931 | 0 | mock_i | 0 | 17,329,512 | 0 | mock_ip | 0 | 9,921,543 | 0 | rsv_i1 | 0 | 1,441,228 | 0 | rsv_ip | 0 | 380,044 | 0 | cym19_1ip | 0 | 2,155,301 | 0 | cym19_2ip | 0 | 741,254 | 0 | cym19_i | 0 | 801,787 | 0 | rsv_1ip | 0 | 1,599,042 | 0 | rsv_2ip | 0 | 1,415,704 | 0 | rsv_agoi | 0 | 320,843 | 0 | m_1ip | 0 | 971,868 | 0 | m_2ip | 0 | 9,969 | 0 | m_i | 0 | 6,091,161 | 0 | cym19_d | 0 | 1,213,959 | 0 | mock_d | 0 | 3,575,771 | 0 | cym19_1ip2 | 0 | 2,831,797 | 0 | cym19_2ip2 | 0 | 3,573,453 | 0 | cym19_i2 | 0 | 924,091 | 0 | rsv_1ip2 | 0 | 2,115,109 | 0 | rsv_2ip2 | 0 | 3,581,821 | 0 | rsv_i2 | 0 | 1,859,587 | 0 | m_1ip2 | 0 | 12,601,168 | 0 | m_2ip2 | 0 | 2,582,005 | 0 | m_i2 | 0 | 11,370,037 | 0 | pvx_i | 0 | 17,579,102 | 0 | HCPro_i | 0 | 19,992,336 | 0 | HCPro_t2 | 0 | 37,383,674 | 0 | HCPromut_t | 0 | 33,952,553 | 0 | Nb_miR173 | 0 | 2,580,489 | 0 | Nb_Leaves | 0 | 2,744,027 | 0 | NNTMV8hr | 0 | 4,987,852 | 0 | NNTMV2hr | 0 | 6,121,523 | 0 | NNTMV0hr | 0 | 6,520,239 | 0 | Nb_1Va | 0 | 8,569,789 | 0 | Nb_1Vb | 0 | 9,824,928 | 0 | Nb_1Ua | 0 | 8,346,491 | 0 | Nb_1Ub | 1 | 9,678,361 | 1 | Ngfp10_1 | 0 | 22,286,071 | 0 | Ngfp5_1 | 0 | 25,811,752 | 0 | Npg6_1 | 0 | 27,341,182 | 0 | Npg8_2 | 0 | 25,013,176 | 0 | Npg_12_1 | 0 | 28,801,695 | 0 |